Description :
From Genome Similarity Track
Location :
Scaffold_79:40656- 42355
Transcript NameFunction/comments
g8557.t1RAW43205.1 hypothetical protein PC110_g605 [Phytophthora cactorum

Sequence
1699 bases(100 bases per row)
CACCAAGGATCCCGACCAGAGCGGCTACGCTGGCATGAAGACGCCTGATGCCAATCCGGACGCTCTCGAAGGCGGCGCGCTTCGACCTGGTGGCGTGCCC
GTGCTGACAAGCAAGAAGTACATTGGTTTGCTCTTCCAGTACGCTGCAGTCGGTATTGTCTACGGCATGCTTCCTGAAACCATTTATCCGTTCATGCAAG
AGTATCTCAACTGCAGTGGCGCGCAAGTGGCTGCTGCCAAGGAGCTTGTTGTGCTGCCGTGGAGTTTCAAGGTCTTTTTCGGCATCCTGTCGGATTGCTT
TCCGATCTGGGGCTACCGCCGTCGCCCTTATATGCTGATCGGCTGGACAGTTTGCATCTTGATGCTGCTGGTCATGGCCATCATGCCGATTGGCAAGCCT
TACTACACCGTCGCCTCCGACCGCGATGTCGACACATCTGACTATACCCCGGAGATTGAAGCTCGTATCAACTACGACGCCCCCAGCGAAGGCGCCAAGT
ACATCATCATCATGTTCTTCGCAGCGGTTGGATACGTGCTCTCGGATGTCTGCTCCGACAGTATCGTGTGCGAACTCGCACAGCGCGAGCCGGTGGCACG
TCGTGGTAAAACCCAGTCGGCTATTTACGCTGTGCGATACGTTCTCGTGATCCTCGGAGAGTTGCTCGTTGGCTTCTGCTTCAACGGTGAAGAGTACGGC
GGCGATTTCGACTTCTCGCTGAGTTTCCCACAGCTTATGATCATCATGACGGTGCTCACCGCGCCTATTCTCCCGCTTGCGTGGTTCTTTATCGAGGAGG
AGAAAGCGGAGCGCGCTGACTTCCGTAAGTACATCAACGAGTTCTGGGATCTGCTGTGCAAGCGTGTGGTGTACCAGATTATCGCGTATCATTTCTTCGC
CGGCATCTTCTCCAGCATCTCGTACACGGCCAGCTCTCCGGTGCAGTCGTACATGGTGGATGTTACGCCGATCAACAGCACCCTGAACGATGTGTTAGGT
CACGTCTGCTTCTTGATTGGTATCATGGTGACATCGAAGTATGGCCTGCACTGGAACTGGCGCTGGATGATCGTCTGCACCGGCATCGTTGTGATCATCG
TGGACTGCACTGTTGCTCTCATCACGGTGTGGGATATCTTCCGTAACCAGTGGTTCTGGCTCGGCCCTCCTATCGCGGTACAGATCCCGAGCGGTGTTGC
TTGGATCATTGCGCTGTTCGTGACGGTCGAGATTGCTGGCGTCGGTAACGAAGGCGCCGTTTATGGTCTGGTGACTACGGTCGGTAACTTGGCGACACCT
TTCGCCACGACGATCACGCTGTTGGTCGACGGCCCGTTCAACATCACGAACGCTCGTGTGCAGGCCGACGATCACTCAATCCGTACGGACATCACGTACA
CGATCATCATCTCGTACGCGATGACAATTTTCTCGTGGGTGTTCCTGTTCCTGCTTCCGCGTCAGAAGGAGGAGACGCAGGAGCTTGCTCGAACTGGCGG
CTCCAACAAAATCTTGGGCGGCCTCACCATTCTCTATTTGGCATTTTCGCTTGTCTGGTCGATCACAGTCAACACGCTGGCCGTCTTCGACAGCACTTCG
TGCCTGGTGATTGCTGGCGGCACTGGATGCTAGAGTACAACGTAGCGTAGACGGAAAGGCCTTGCTTGTCTCCGTACAGAATGACTGTAAGCATGTACA