Description :
From Genome Similarity Track
Location :
scaffold_147:40649- 41838
Transcript NameFunction/comments
g4603.t1 myotubularin-like protein

Sequence
1189 bases(100 bases per row)
CGAGCCATTCTCACTGGTGCCAGCGCCATTGACGTTGGCGTTGCCGTTGGAGGCGCTGGTACCGCCCCGAACGGCGCGGTGAAGAACAGAATCCAGTTCA
GCCTCCAGCTGCAGCTCACGCGCGACACTCTCGCTCAGGAGCTGCTCCAAGTACTTGATGCGGCTCTGGTCCGGTGCCAGCAACAGCGCTTCACGTATGT
TACGACCCTGGGCGCGCTGACGAGTGCGCTCCTCGGCTCCACGGTGATACCGATCTATCAATCCCCCATCCATCGGGATTCGATTCTCCGAGTTCTCCGA
ATCGGCCTCGCTGCTTGCTGGCGTCGTCATGTTGAGCTCGTCCGGTGTCAAAGTCGACGAGCCATCATATCGTGCAGTAACACTCGGAGAGATCTCAAAG
TCCTCGTCATCGCTCATGTCCGAGCAGTCCGATAAGGTCTTGGTCCGGAACTCGTCGTAGTCGTGAATCACGTCAATATCTAACTCCGCCTTGTCTTCCA
GATCGCCACCGATAGGCATTACCGATGGAGAGTCAAGGACACTCGCGCCTCGAGGACTCTCGTCTTCATCGAAATCATGCGCAGAAGTGTCGTCGTCGGC
TTTCTCCACGGGATCCATGTACTCCATGTAGTCTGGGTGGCTTTCCGGATCCCACCGGAAGAACATGCCGTCCCACAACACAACGCGCTTGAGGTTTGCG
CGGGGATACAGCACACGGTTCGTTGGTCGGTACAAGGGGTTCTTGTATGGTCCCGGGTTCTCGAGCACGGGCGTCCATACAGACTCTGTGCGCTCCCACA
CCTTGTCCAGCACACGCTCGCGCTCCGAGTTGTACAAGAACGTGCCGTAAAGACCGGAGATCAGCGAGTCTGAAATGTGCAGCAGGAATTTCTCGTTGAA
CTCGAAGCACGTGGGGAACTGCCGGGTCATCTGCCACACGCAGTCCAAGAACTGCAGCATGACCGGGGACCGCTCGTTTGGCTGGTCCGTAATGTCCTTG
CCCACACCAATTCGATCCGCGAATTTGTGGCCAAACGAACACCACTCCTTCTCCACCAGACTGGCAAAACCACGAATGGAGCGGTAGAACGGGTCCAGGA
TGAGCTGCGCCAGAGCCACGAGCTGCGGAGTGCGATCCCAACCGTCACTACAGTGCACTAGCACGGAAGCGCCGTCTTCATGGAGCACT