Description :
From Genome Similarity Track
Location :
Scaffold_196:4064- 5481
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_196-fgenesh-gene-0.2Amino Acid/Auxin Permease (AAAP) Family

Sequence
1417 bases(100 bases per row)
TAGTAGAGCTCGTGCTGGTGCTCAGCCTTGCAGAATGGGAACTTGACGGCAGCGGTCTCGTCTAGGATGAGTGCCTTGCCACTCTTGTAGGTCACGTACG
CGCCAGCCACAGCGCAAACAATGAAAGTGATGACGGCGATCACCTTCTCGTACATAGGCATAGCGGCGCCCGACTTCTTGATGTGGAATGCGATTGGGAT
GAGGATACAAAGGATCGTGTTCGCGCACGCACCAATGAAGTCGGAGAGATCGACGAACTTGTGGCGCAGCACAACCGCGACAATCACCAGCACGATGATC
AGCACCACACGAAGGAGCACGTACTTGAACACGGTGCCAGCACTCTTGTACTCAGCGAGTTCCACATCATCCTCATCGTTTTCAATCTCTGGCTTCCGGG
AAGCGTTGCTCCACGTCGACGAGCGCTTCTCAAGGTCCTGTGGAGTCTCATGCGAGTTATATGGGAGGGCATCGTCCAGAGGCTGCAACGACTGGTGCTT
CGGGCGGTGCATACCGAGGACGAGACGCTCAAGCACGTAGAACGCAGGGTGCAGGAACACAGCGAACGCGATGGTCACGTGGAGCTGCATGAACAGGTAG
GCGATGGTCGCGAGGCCCCAGTTGGACTTGAAACCGATCGAGGAGTAACCGTTCTCATCTGGGAAGACGCTGAAAAGCAGGTTACCCGAGATCTGGCAAC
CAaCAGCAGAGTAGCCCGAAGCAGCGAGCACCACAAAGAGGAGCGTGATGGCCGTAAGGGTAATGAACACGACCTGTGGCATACGCTCTGGCTGCTTGTG
CTGACGCTGAACGGTTGGGATCACAATAGCGCTACCGTACGCAAGAGCGAGGTTACCGAAGGTCGTCACGACCTGctCGAGCGAGACATCAGGCTTCGGA
ATCGATGGgTGACCGTCCATGGCCTGGAGCAGGATGGCAaTACCGGCGACATCCGCCACGATTGTACCGACGCAACCGGCGAATGTCGACGCGGCACCTT
CCTTGAGCGTTGGGgTCAGTGACACTGGCAGCACGATGACAGCCATGAACGCGATCCAGAAAGCCTGGCTGTAGGCCTTAGGGAACAGAGCGCTCAGCAT
GTTACCGCCGAGCACGAGGAAGGCAGCAGCCGTAAGCAGACACACGAGCATCTGCGCGCAAATGACGAGGTAGCGACCGAACGGACCCATGATCCACTCA
CCAAGATCACTGAAAGTCTTGACGGTGCGTGGCGCCTTAAGCAGCGTCTTGGAGATGACGACCGACGAGTAGACATTGGCGAAACCCATGAAGGCCATGG
CAATGACGGCGAAGACTGGGCTGGCACGCGCAAAGTTGGCAGGCATACCGAGCGTACCGATACCGAAGGCACCGCAGAAGATGCTGAAGGCAGCAATCGA
GTCCTCCTTGGTGAAGA