Description :
From Genome Similarity Track
Location :
Scaffold_1496:4063- 6429
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1496-snap-gene-0.0Gag protein

Sequence
2366 bases(100 bases per row)
CTGTGGATGAACACATCATCAAAATAGCTCGGTGCGAAATCGCGCACCGAACGCAGAAGATGAGTGACACAGCGATTGAATGTCGCTGGGGCGTTCTTGA
GGCCTTGAGGCATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTC
ACGCATCAGGATTTGGTAAAATCCGTCCCTTAAATCGAGAGCACTAAAGATGGTGCTCCCGCTCATGCCATCAATGATGACGTCCTTTCTCGGTATCGGC
GTTTGCGCCGGTACTGTAGCCGCGTTCAGCTTGTTAAAAGCGTGAACGATTCGCCATCCTCCTGTGGCCTTTTTCACACAGAAGGTGGGGCTGCAGTGCG
GAGAGGTGGACTCGCGTACGTGTCCAGCCTTTGATCGCGCCTCGAAGAAGTCATCGATGGCGGTGACTTGGTCACGCAATACTTCGTGCCCGGCACGAGG
TCAATCTCGTGGCGAGTTCCTTTGTCATGCGGGAGCTCGCACGGCACTTCCTCGGGGAATACGTCAGCGTATTCTCGGAGAACCTCATAGAAGGGAGAGG
TTGCCTTTAACGTTTCCCAGCTCTGAGTTGCGAAGCGTTTGATCTTTGTGGGATCGCTGCGTACGTCAGCGTCCTCAGTGGAAGACGAGTACAACATGGA
CATCTGAGATCGAATGTCCACGAGATCTTCTTGGCTCGTGATGATGCAGATCTGCTCGATCTCATTATCGTGCAAGTTCATTAGAAACTTCTTCCAGCCC
AGAGCTGGTAGACGCGTGACCTCCGCGGCCGACTTCGGAGGATTCTGAAGTCGCAAAGACTGGGTAGCTAATCCAGCCTCATGCTGCGCCAAGATGTTGA
TCGTCTCGGCGTCTTCCGGCTCCTTGCGCCCAGCCACCCCTCGTGGCTGAGCGGTTTCCTTGTTTGTCCCAGTGCAGCTCGTAGCGAGTGCACTGGCTTC
ATCTTCTGCGGCATGACGGTCTTTATCGCCCATGCTGTGCTCCTCCTTGAGCAGTACGTGTCAGTCGTCAGCGACTCCACGTTTATCTTCCTGAGTACCA
CGGGGGCTCTTCCCGCTCGTGGTACTGTTCGTCTTCGAGTCGTGACAGACTCTTCTGTCCGCGACTGTGTCTTTTCTTTCACCGCGAGGTTGCGCGTTCC
TCGCGGTGGTCTTTGCGCGTCCAACATAACGCTCGTGCAAAGACACACTCACACGTTCGTCTACAGGACAGACGGGGCCATCGCACACCGTGTCACTGTA
GTGTNNNNNNNNNNNNNNNNNNNNNNNNCGAGTGCATCCTCTGATACACTCGAAAGATGGAGAGGAACATTCCTCCTCCTCTTTTGGTCCGGGGTGGACC
ATGCGATTGACTGGGTCTTCCAGTCGATCGATGGCTCGTACTTCATCATCCACGGCATACCGAGGATGATGTCAAACTTTGAATCCAGCTCGAGGACAAT
GAAATCGTCCTCGAACTGTTTGTCTTCAATTACGAAACGCGTGCGAATCACACGTTTCGGGACTTCTACAGTGGTGCCTGTAGCGAGTCGCACTACAAGT
CTCTTGTGAGGGGTTTTCACCTCCTCATGGAGCAACTTCGGCAAACTTTGTGCCCTCACAAAGTTGCTGGAAGCCCCAGTATCGAACAGCGCACGCAAGA
TGGTAAGATCTTGCGTCTGTAGCTTCAGAGTGATGAGCGGTCCGCCCTCGCTCTGCTCCTTACAACGAGACAGTGTCTCGTCGGGGGCTGCAACCCTCAC
GTGTCCAACTTCGACTCGTGAAGGTGCATGTCCAGTAGGGCGCCCTGCGCCTACTGGTTTACCTCGTTTTTTGCTTCAGCGGCGCGCAACTGGTGGCGAG
GAGNNNNNNNNNNNNNNCCAGTAGCTTCAGATCGCTGAGCGCGTGGTGCCGGTCGCGGCGCCATGCATTCGTAGGCAAAGTGCCCGTTCTTTCCGCACCG
ATTGCATCGGAGCAATTTCTTCTTTTGCGGTTGACTCGTCTGNNNNNNNNNNNNNNNNNNNGAGAGATCCATTGGTTCCGGGCCGTTGTGGCGCGGTCTC
GGCGCGAAGCTCCTAAAGCCTCGCGACATGTTTCCGTGAGCATAAAGCTTTGCCTGCTTCATGCTGAAATCTTCTTGGATGCTACGCGATATGGCATCCT
CGAGTGTTTTGGAATGGTCCCGAAACAAGTAAGTCTTGATCGGTCCGTCGTTCAAGCCTTTCATGAAGACGGCGATCTGAGTGGCCATGTCGATGGGCTC
ATCAACGACATTGGAGACCAGATAGCGGGCTTTTTGGGAGTAAGCATGGATGTCATGCTTACCCTG