Description :
From Genome Similarity Track
Location :
Scaffold_39:40626- 47858
Sequence
7232 bases(100 bases per row)
CCTGATCAGCGCGCTAGCTACTCTTCACAAGTTCAGTCAATACTTCTACAATAGCCAAACATCGGACTTCATCTCGACGGCGAAAGACTTCATCATTAGC
TACGCCGATTATGCCCGTCCTGATCCAACGATGGCGCGTCTACTTGCTTTCTGGATCAACGGAAAATTCAGCCTTTTCCGCAGCAAAGTTCTGTCAGAGG
GCTTCAGCGAGGCGGTCAATGTATCAGCCCAGTTTTGCCGAAGCGACGATAAACTCGCAGCTCTCCGAGACTCAAACCAATACGAAAAGCTATCGTCCTC
AACGCGTGCTCGCGCCTCCGACAACGAACGCAATCCGCGCGAACCTCGTGCGTCAAACACTAGCCGTATCCCACCAGAAGAATTTCCCCAACTTTCGCTC
GATGAGGACGGACGCAGACTGTGTCTGAAATATCTGTCGAAACCGGGCTGCCAGTTCTCGAAATGCTCCAACGCCCACTTTCGACCAGGCTCACTAGCAG
ACGGAACACGAAGGATCATCTCGGAGCGTTGGGGAGGTCTCAGGACTCAATTTACCGATTTATGACTACCTATGCAGCGGGTGCGATCGACAAGACCCCC
CCCCCCCCCCCCTCTCAACCCAGTCGCGAAGAGGAGAGCCAACTGTGTTACAAAAGCTTCATGTCAACGCTGCATCGCATTCGGGCCACGAGCCAAGCTT
CCATCCATGAAAATCATAAGAACAACAACGTTGGATTACAGCTACCGCCACTCCGTCCATGAAATCGACAACGACCAAGTTCATTTTTGGTCCAACTTAG
CCGAGCTCGGCAAGTGGAAACTACCGGATATCGTGCGGCTCTATCGCGGTCAAACATCATCAGATCCCAGGTCCAATAAAGATCTGTACGAAATTTCGCC
GCCGGCCGACCCCGCGCTAGTCCCAATTGTCGACAAATGGAGCGGCATAGTCCGACACGGCGTTCGACCGGAATGGATCAACGGGTCGACTCCAATACAG
ACCACACGTCCTCGAGACCACTCTGGTATTCAACGCTTGACGAAGCTGATACGTCGTCACTTGCGCACCGGACAACTTGAAGGCAAATACCTCATTGTTG
ATGTGCGGCTCATTGATCAATGGACAGAAGTTTTCGTCAGCCCACTCGGAGCCGTCACTAAGACCGGGTCAGCAGCAAGCGATATCCGCCCAATAAACGA
CTACTCGATTCCACGCGGCGCGTCGGTCAACGACCACACCATTCGGGATGGCTTCCCTTCGATCTCGTACAATCGCTCTCGGGGTATCGCAAAGCAAATT
CATCTTCTCACATCGGAGAACGCGTGTTAATGATGCTCGGGGATGTATCGGGCGCTTTCCGCCACATCCTGATACATGCTGACTCGGTTCACATGTTCAC
TTTTGTCTTCGAAAATCTTCTCGCTATCGATCTTCCGTGCGGATTCGGCTGGTGTGAATCACCAGCCTTTTATTCACTCGCAGGCTCCATCATCAACTCG
CTGTACGAGCACGACAGCCAATTGAGCCGCCGGTTTACCGGTAACGTGTGGTGCGACGACCACACGTGCATCGAGGTGGACACCGGATCGAAATGTTTCG
ATGCCAATCTGTCGCTACGACGAGCGATGGCCACAGTTCTAGGGCCTACCGCGATCAACGAGCAGAAGTTCACTGTTTGGTCCACCGACTGCAAGGCATT
GGGGCTTCTGTGGGATACGATGACTGCGACAGTATCCATACCCGCTGAAAAAGTTGCCAAATCATCAACTCGAGTCCAACGTATACTGTCCGACGGAATC
GCGTCACGAACCGCCCTCCTCAAGGTGATCGGTAGCCTCCGTCACGTGGCTAGCTGCTTTCCACCCGCGCGCGCCTTTCTCCAATGTCTACAAGAAGCAG
TGTCGGGGTGTCCTAAGTACGGCCAAAGCCCGCTGTCATCGTCGACAATCGAAGACCTTCGTTGGTTTCACGCCTTTCTTCTCCACCCGGCACGATTCAA
CGCGATACCCGTCATTTATTTCGCGGAAGTATCGGAACCAAAATTTCATGTGTTCATGGACGCCAGTGGAGACGGACTATGTACGCTCGAGCTTACTTTG
AAAACTTACATTCGTCAGCGATTCTCGGACCATGACCGGCAACATGACTCTATCAATGTCAGAGAGCTCCGTAGTGCAGTCCTCGCAGTTCTTCATTGGG
GACCATACTGGGAAGCAAGAAGTACAACGACGCGTGCGCACGTCCAATTCCATATCGACAACACGAGTGCAGTCGCATGGGCAAACCGACGCACGAGCCG
AAATCCAATCGCCAAAATGTACAATCGACTACTATCCCTCGCCGAATTCCAGTACAACCTCGTTTTCACCGCAGCGCACATCTCCGGGAAACTTAACGTT
ATGGCCGACGCCGGATCTCGCGTGTGGACGACTGACCACCCTCTCATTGGCGTATGGACTAACATGTCGTCTTCGTGGACACATACTCGACTAGAAGAAC
CTTTAGACAATCTATCCACTGTCTGTGATCAATGCTCCGCCGACACGCCCTGGCAGACTCTACCACAGCCACGTACAACCGACACTGGAATCAGTGGTGC
CGATTCGCCAAAAGAATGGGGTGGTCAAGATGGTTAATACCCTCGACAGCCTCAAAACGACTGGGGTACTTCGCCACATCCTGCTGGACCGGTGGACAAA
ACACTCACCACAGCGGAAATCAGTTCTCTACAATCAAGTTAAAACTCGCCATCATCCGCTGGTTTCATCGCCGATACAAGGACCTGTCCCTGCCAACAAG
CCCGAAGCTCGACCTGTTACTCCAAGGTATCAAACGCCTGTCTTCACCTCGATAATAGAAACAGCCGCTGACTCCGTCATTCCTGCGTATACTCCACCGC
TCTCTCGATATTTCCAAACCAAAACAGCGCTTGCTATGGGAGAGCATCGTCATAGGCTACTTCTTCTTTCTTCGGAGAACAGAATGCCTCAAAATTGGCC
AAACGCGTCGGTTCTACTGCCTGAAGACCAACAACGCATTTTTCTCCGACGACAACGGCAGACGCGTGACGCGGAAACTTGCCACATCCGTGACAATCGG
CCTGGAAAGTGCCAAAAACGACCAATTCAGTCGTGGCGCCCTGCGTACCATGAATTCCTCCGGCGACAAACTGCTCTGTCCAGTCCAAGGGCTCCACCAT
ACTCTCCGAGCACGAAAATTGCTAAAGGTCGATGAACACCGGCATCTGTGCGCCTCGCTCACAGCCCGAGAGGTTGTAACAGCCATTAAGAACACGGCGC
GAAGGATCGGTGTTCCTGCTGCCAGCTACTCGTCTCACTCAATCCGAATTGGAGGCGCGACAGCTCTAGCCGCAGAGGAGCAAACAAGCTCTCTATAAAG
CTCCTCGGTCGATGGCTATCAAATTGCTACGAAGAGTACCCGAGATTGGCGCCCACGGAGTCAAAGGGGTTATCGCAACGAATGATACGACCAGCCCAGT
CATCACGCGCGGCGAGCAATTAATCTCAGCTCTGGGGCCGCTCACCACGCGCTCCGACTCGACCGCAGCAAACAATACATCTCTTTGCCCCAAGTGACTT
GCGTGATGGAAAATGGCTTCATCCTCTCCTTTCATATATTTTATCTAATTTTATGTAAAGACGAAAATATTAGTTATCGCACTGGACCTATACTCGAAAT
TCTTGCCCACAGTGGATGTTGGCACTCATACGAACGACAAGATTAAATCCGGCTCTTAATGAGGCCAAATCGGAGAGCCGACTTTACGGAGCATTCACTG
CATGATTTTGATTGGTCTGTCAACGGAAAAAAAATACAAAGTAGGGATCGTGGGCTTTACATAACTATCACGCTTTGTTTTCCCGAGCAAGCCGATCCAA
ATATATGATCAATATGCTGGAGGGCTGACGAAACGGAACTTAATGGACCACTTCCCTACTATAGATGGGTATGACAGCAGCTCGAGAATCTCCATCGCCA
TAGATAACCTGCCACGCCACGCCCTTATAAGTGTGGCAGAACGACAGACAGTCATTTGCCCCGAACGTGCGACTTTGTTGGAAATGAGGATTTCAGGTTA
CTGACACAGTGATTTCCGCGATTTGGCTATTCAGAACGCCGCTCCAGATCGGTGCCGGGCACCCCTCCACCTACTCGCGATCTCCGCCCTCTTCCTTGAC
GCGACATTGCCCCTGCGACCGCAGTAATGACACCCGTGATGACAGCGGAAACCGCGCGACCCATGGCCCCCGGCGCCACCACTACCCGTACGAGCTCGCC
GCTCGCTCGCCGTCCACAAGCGCTCGGCTGCGGTCCTGGCCGAGGTGGGCAGCCAGAAAAAAATGAAGCTCGCGGTCACTCGCCACGCCGCGTTCAGCGA
CACTACACGAGGTTAATCAGTTTCGGGGGGGAGGGGGGGGGGGTCTGCGTCTGCTGTTCTTCTTCCTGCTGACCAGGCGCTCGGAAATTGTGGCCATCAC
ACTCACCAGCTTCGAGTGGTTCGCGCTCAGGCCCTCCAAAGTCATGGCGATCGACGTATCAGGTTCTTCCATGTCCAATCCCAACGCGGCATCCGCGGCG
TGTATTCGCCTAAGCGGATCGAAGACAAACCAGGGCGGAGCGCCCATCTCGCGCGTGCTAGAGCGCTCGGGACATCCGTTTTTGTGTCCGGCCCTTGGTG
TCATGCTACTGCTCCAGACGAGGAGACTGCTACCGGCCACGATCCCTGCGGCGGTATTTATCGACAAGGATGGCTTCACCTGTTGTGTGTCTGCAGTACG
CGTGGCGACTGTGATCCAACGCGGAGTACGCTCCGCTGGCGAAGACCCATCCCGCTTTAGCACTCACTCGCTCAGGTCCGACGGTGCCACCAACATGTAT
CGGGGTGTAGTGGACCCGCTAACAATCCAATTGCACGGCCGCTGGGCCTCGGACGTATTCAAGCTGTACACTCGCTTGTGCCGGGAGCTGGTTGCTGACA
TCGCAGGGAGAAAGGTCGGTGGCGCTAAGGCATCTACAACGTTGCAGTACGGGAGTACATCTACCACCCTATCACAGGGGCTGTAGCGCGGTATCTGTAC
TTCCGTATCTGTAACATGTTAAAGTTTGCCCCATAGCTGTCTGTGCAAGATTTGAGAGGAAAGCAAGCATTTTGGCCACTATGTTTTACTCATCCATACA
GCTTTGCAGAACGGTGCTGTCTAACAAAAAGGCACGATTCGCATGAATAGAACGTTTCGGTGGACGTGTTCGTATCTGGCAATCCAAAGCTGTATGATAC
ACTTATATCCAACACCTCCCTGCATATTGAATACCGTCGGTCATCGAGCGCGTCTTAGAAATACTTACACATCATCAATTCTGCCGAGACAGATCTGCCA
AAAAAATCGGTTGGGTTTGCCACTCACCCGTTAAAGTAACTTGGGGGTGAAACTGATCCAGCTCGACAAGCCGAAACAATTCCTGTGGCTTTACCCCAGG
ATCAAGCATGGAGGGTTCTGTAACTTTTAGGGCGAGACAGGGCGATAGGAAGCCTCACGAAGCAACGTTTGCTTTAGTATCATATAGACCATGACAACCG
TCCATGTAGTTGCGCAACTTCGAAGCACATTTGACAATTTAGAAATGACTTAAGGTGCTCAAAGTTGTTTTTTGTTGTTTCGCAACATAATATCTCGTCA
ATGGCGCCGCCACCCGCGCTGTGGGCCGTGTCGTGCTCGCTCCCCGCGCCGCTCCAAGCGCTGCCGCACGTCCCTGACCTCGTCTCGTCGTTCTTGCTGC
CCCCCACCATCGACAGCGCCGTGTATCACCGTCTGCTACGCGTCACCCGCGCCTACGAAGCCTTTTGCCCCTTCACAGTCGGCGCAATGGACGGTGCTGC
AGCCCGAGGACTTCTGGATATTGTCCAATGGCTGCATGCCAATCGACCGGAAGGCTGCTCCAACGCCGCCTTCATTGGAGCTGCAACTAACCACCACCTC
TGCATACTCGAGTGGTTGTATGACTTCTACCCACAAAGAGCCAACCCGGGAGAAGAAATCGTGGCAGCTGCAGGACATGGCCACGTCTCGGTGGCCGAGT
TTTTAGTATCCAAAGTGAGGAGGGAGCAGGTAGAACCTGCTCTCGAAGCTGCCGCTGGGAACGGGCATGTTGCAGTGCTGCAAGCTCTGCTGGGACGTCA
ATATAATATGCGGAAATCGCTCCTTGCAGCGGCCAGGAACGGACAGGCAGAGGTGGTGCAATTTCTACTAGCAAGGGGTTGTAATGATCGATACGTTCAT
GTGAATCCGGCGCTGATGGAGGCGGCGGAACGAGGTCATTGTGGCGTGGTCGGGTTGCTGCTGGAATTCAGTGACGACTTTACGATTACTGACGCGTTGA
GTGCTGCGGCGGAAAATGGATGTACGAGTGTGGCGGGGCTGATTTTGGCGAGATGTGAACTTAGTAAAGTCTCGGTGGCTCGTGCGTTGGAAAAAGCAGC
GGAGAGAGATCAAGGTGACGTGGTGAAGATGTTGCTGGAGAGTTTTTCTCGAGAATTGAGTACGGGATCCGGAGACTGTGGTGGACAGAGACTATCGCAC
CTCCGCTCAGTAAATTTCACCATTGATCTCTCGTTCATGTCAGCTGTGGAAGAAGGCCGGATTAACATTGTGAAACTGCTGGTTGATACGGTCTCACGAC
CCATTGAAGATATTCTGCTATCTGCTGCATCTCACAATCAGTTGCCAATAATGGAGTTTCTTTTGGATTCCTACGAAGAAAAACACTTGAAAGGGACTTC
TTTCAATGAAGGCGTTACCTCTGCAATTGAAGCAGTAGCGTCAAGTGGACTCATTGAGATGGCTGAAATGCTCGTTGGTAAATGTGCAACCATGGACACA
GGAGCTGCCCTGAGGATGGCAGTGAAAAACAATCATATCGAGATGCTGAAAATACTTGTGGAGAAGAGTAATGCAACTTCGATTGGCGATGCTGTAATGG
CAGCAGCAGAAACTGATCAGATAGAAATGCTGGAGGTTTTGCTTGAAAACTGTGATACAGACGTGATCGAGCAGGCCCTGATCCGGGTTGCATCGATTGG
TAGAGACAAGTTGTCAACGTTGCTCCTACGAAAATGCAATCGTCGAGCATATAGTCGCATTTTTGAAAACGCTGCAAGGCATGGGCTTGTCGGATTGGTA
CAGTTGTTGCTTGATAAGATGAACGTGCAAAG