Description :
From Genome Similarity Track
Location :
Scaffold_144:40626- 72866
Transcript NameFunction/comments
g18438.t1XP_008903361.1 hypothetical protein PPTG_10418 [Phytophthora parasitica INRA-310
g18439.t1hypothetical protein
g18440.t1ETI50705.1 hypothetical protein F443_05835 [Phytophthora parasitica P1569
g18441.t1hypothetical protein
g18442.t1RAW40541.1 hypothetical protein PC110_g3261 [Phytophthora cactorum
g18443.t1ETI50709.1 hypothetical protein F443_05838 [Phytophthora parasitica P1569
g18444.t1hypothetical protein
g18445.t1RAW40538.1 hypothetical protein PC110_g3264 [Phytophthora cactorum
g18446.t1RAW40537.1 hypothetical protein PC110_g3265 [Phytophthora cactorum
g18447.t1RAW40535.1 hypothetical protein PC110_g3266 [Phytophthora cactorum
g18448.t1hypothetical protein
g18449.t1POM73472.1 Hsc70 cochaperone [Phytophthora palmivora var. palmivora
g18450.t1hypothetical protein

Sequence
32240 bases(100 bases per row)
ACGCGCGCTCCACAGGTCGATTCGCACGTGTCTAATTGATGGGGAGGTAGAGGAAACGCTGGAGAATTTCACAAGACTTGAGCTGCTGCCGGACGTGGCC
TGTAGCCGGTGTGGCAAGCCGCCGCGTCCGGAGAGGAGCGCGCGCAGCATTGTCAAGTGATACACGAAGTATGTGGTCACGAATAATAGAAATAGGTCAC
CGATTGAGGCTAAGAGTACAATTTTGTTGTGAAAGGTGTATCGTGTGGTGTGCGATACACCTGTTACAGAAGGCACTGCTGGGTCTCATGTTGGTTTTGT
TTCTTGACTTTTTTGCTGCATGGGACGAGTGCTCCGATCCCGGTTGTGCGGTGTGGGTGATGCTAGTCGATGTGGTCATGGACTATTTTTGATTTTGTGT
GGGAAGTGGTGGTGGAGAAATATTGACAGATCGATCGCAGCTCATTCGTTTCAAACGGACTTACGTTGGTGATGAGGGAAGTGGCCATTTCCCCATTAGA
CGGCTACAGATCACACACGACAAAAGAGCCTTTTGAAGGTTCCCCGTTGAAGCCAACAAGTCCGCAAACATGATGACCGAGAACAACAACTTGCTGTACC
ACCCAGGCGATGGTGGTTTTGACCGCCTTGACGGGATGGAAGGCGGAACACTCGCGCGAATCCCAGTTTTGCGGTCGGTTCCGGTACCGATGACACGCCC
ATGGGCCACCCGCGGGGCGATTACTTTGCTTCTGGTGTGTGGAGTGGTGTTCGGCGTCATCGCGATCGCAAGCATGAACAACGGGTCAGAGACCACAAGC
GCGGCAGTAAGCGCCGAGGGGCCAGCTAATAACGCTAATGTTGGTGGTGTAACGATTGTGAGTGGGTCAAGCAGCCTTGTAGCTGACAATGGTGCGACTG
GGTCGACGTCGACCGATGAATCTACGCTCGGCTCTTCCACTGCCGACAAGTCCGAGGATTCGTCAGTTGACACTTCAGACGACTCGCCAAGCGAGGCAAC
TGCTGGTCTATCGGGCTTGAACGAAGAATCGGCGAGTGGGTCGAACCACAGTACAGGTGCCTCGTCCTTTGAAGAGGTTATAATCAACCCACTTGAAACC
TGGACTGACGACTCACAGCTCGGATCTGTCGAGGGCTCGGCGTCTGACGCGTCCGAGTCGCAGAGCGCATCGTCGGGCAGTGAGCAAGACTTCCTGATTT
CGGGCTCGGCTTCCACGGACGCTTCCTTGGACACTTGGATTTTCGATTCGGTCTCAGGATCTCAAGATTCCTCGATGGAAGATAGTGCTTTGGTTTCTGA
CTGGCATTCCTCGTCCGCAGACGACGAGAACAGTGACTCGCTCTCTCGATCGGAAGACAGCTCGTCAGGTTTATAAGTACCGCGAGGGCGACCCTTTCGG
ATCGTTAACGTACTTGCCAATGCAAGTCTGCGCACAACAAACTTTTATGCAAATACATTCCATTCGTCGTATGTAGATGTTGGAGCTCGCAGACTTTCTC
CTGGCCGGACTTGGTTATTAGCACGTCCATTTACGCCTCTCGCATTGGTACTTCCAGACTCATCGGCTTCCGGGCTGGGCCGTCGACACGGCTGGTAGAC
GTCGTCATTGGATCGACAACCCCAAGTGACTCAAATGGCTCAAAAAGGTTCTGTGCTCACTTCAACTTGCAGATATGTTCCCGTATAGGTTAATGCATTC
GGCTTTATAGGTTTTCTTATTGGGCCATTTTCAGTTTGTGTTTAATTCTAGAAGATGGCAGTGGCGAAGAACTTGCTGGCAGTGCGAGCCAAGGTGGCGG
AGGCGGTAGGCAAGAGCGCGTGGAAACAACAGTGCACACTGGTGGCTGTGAGCAAGACGAAACCCATCGAGGACCTGCAGGAAGCGTACGAGGCGGACCA
GCGCCACTTCGGCGAGAATTACGTAATTTACCACATTGGTATTCTATTTATGGCAACTCGTGCTTATTTGCGGCAAATTTATGGTACATAGATCCAGGAG
CTGGTGCAGAAGGCTCCGCTGCTCCCGGCTGACGTCAAGTGGCACTATATCGGCCACGTGCAGTCCAACAAGGCCAAGCCGCTCGTCCGTGACGTGCCCA
ACCTGTTCGTGGTGGAGACCGTGGACTCCATTAAGATCGCCAATGCTCTAAACAAGGCGTCGGGCGAGTTCCGCTCCGAAAAGCTCAACGTCATGGTACA
GGTGAACACCAGTGAGGAGGAGCAGAAGTCGGGCAGTGACGCTGACAGCTCTGTCGAGCTGGCCCGCCACATTGTGACGGCGTGTGAGCACCTCAACCTT
ACGGGACTGATGACTATTGGACGTTACGGAGATACCACGTCTGAGTGTTTCGACCGTCTGGTGGCTTGCCGTAAGACTGTGGCTGAGGCTATTGGAAAGG
CTGAGGCGGACTTGGCTCTCAGTATGGGCATGTCGGGTGACTACGAACTCGCGGTGAGAGATTAAAGTTGGTTTTGAATTGTTGGTGAATTGTGCTGATT
TGCTTGTTTCGCTTTTGTTGTTGTGGCTTAGATTTCCTGCGGAAGCACGCACGTTCGTGTGGGTTCGACCATCTTTGGTGTTCGCAACTACGCTAACAAG
GAGTAGATCATCTCTCTGCTTAGTGGCTCAATCTGTATTATCTTAGAGTAAATCAAATGCCAGTGCAGATTGCAAGTCGAAGCTTCCGTGCTTGTTGTTC
TCGGACCACTTTGCAGCCGCACGCTTCGCGTCTTCGGTAGTCACGCACTCTCTGGTTGGGTCCTCGTTTTCTTTTTGCTGTTGCTGGTGGCGATCAAGTC
TCTCTTTCTCCTGCCGCACTATGTCCTCCATGTCAATGTAGGTTGTCTCTGGCTCGTTAGGATACATCTCGCGCCAGGTCTTTCCCGCCTCTTTGGCCTT
CTTCTGCATTTCCTCCACTTCGGTGCGCCTCGTCTTTCGCTTATCTTCCGATTCTTTTGCTTTTTGTTCACGCTCAATCCGTCGTTGCTCCAAAATGTGC
ATCGACATCATGTCTTTGCGGTGGAATCGGTCCTCTGGTAGCTCCTCATCTTCCATGACAGGGTCCCAGCGTGGAGCCTTCGATGTAGGTCCAGCATTAG
ACGGGCTTCCGTTCGAATCGGCGGCATTCGCGAGGTGGAACAACTCCACCAGTGACTTGGGCTTCTGTTGGACAGAACCGCCTGTCGTTTCTCCATCTTT
AGTTGCTGGAGTAGCTGCCTCATTGTCCTCGTTTAATGCTCGCGCAAGAAGCCACGGTGCAGAGCCGCAATCGGGACCAGCAGTATTCCAGGACTTGGCG
ATCGTGAGAGTTATCTCCATCGAGTTGCTGGTTCGATCCAAGCAAACTTTTGCAGTATCTACTTGGACGGGATACGGAAGAAAGATTTCTAAACGAGGCC
ACAGCAGAGCCAAAGTTGTTAGTTCTCGCCACAGTAAAGTGGCTAAAACCTTTGCACATACCTAAATCATGATGAGTGGCCGCCTTGACATTGAGAAGCT
CGGCTTGGAGCTCCAGGTCGACATCACTGGCAGCTTGCACCATGTTTTCAAACCGGATAGATATGATAAGCCGAGAACCGGCTTGCTCAAGTGCCTCTGG
TGATAATGGTTCACCGCCCTTCATCGTGGAGTGGGGTCTTGAGCACGTTGTACGATTACCATCGCGCTCTTCGAATACCTCAAAGCGCGCTGTCGCCGTC
TTTGGCGCTCTCGCAGCTTTTGCTGCCTTCTGTGCTGTAATTTTCGCTCTGTTTGTTTGCTTGGAAACTCCGGAGTTACCAGCAACTACTTCCTGGATGA
TTGGTGCCTGGGTTTTCCGAATGTAGTGCTTCGGCGGGGGTAGTTCTCCGCGGTACGTCAACCGGGGCAGCTTATAGCGGTCGTCGAGCTTGATTTTGTA
CTGGATGCAGCGCAGCATATCAGTTAACTTTGCCTAGTTTTTCTTCTACGGGAAAAGGCGTCTTACCTTTTGGTCGATGTACTCTGTTGCCAGTTCACAC
ACGAAGTTACGGAATGCGCCTGTTTTGTCTGCTTGACAGTCTTCTACGACCTTCGTGTTCACCGCCACGTCAAATGCCAGCGCACTCACGCCCTTCTTGT
CCTGAACCTCATGGGGCGCCCCGAGACTTAGTGGCACATGAATTCCCTGACCATAAACCGCAAGTTATGCCATTGGCTCAAGCAACTTTTCCAGAAGCAC
GATGGTACAAGGGTGCTCACCTCTTGTTCCTTGCCTTCTTCATCCAGCTTCTTCTTCTCAGAGAAGGCCTGGATTTCATCGGCGTAGACCACATTCACGA
ACACCTACTCCATGCAGCACCGGACAAGGTCAGACATTTCGCTGGTGGCTGAATACGAGGTTAGCAAGCTCACGACCTTCTTTTTGTTCTTGACATCACT
CGTCTTCATCACGAATCCAGGCTTCACGTCGATGTACATCTACCAACCAGCAGCATATTTACTTAGTGCCTTCCACCTCCTCCACCCTTCCTCTAGCAAG
CCAAAAGGTACCCCTTCCGGCGTGGCTTTCAGGCCGTCGTCTCCCATGACCTTGTCACCAGGAAACCGCGGCTTAAAATCTGACAAATATTAATTGCATA
ATGCAGCACGTTAATAAACTTCATACCACCAAAAACCAAGCTTCCCTTGTGCCATTTCAAACCTGGTGCATTGCTGTCTGTGGCTCCTCCCCGTGCTCCT
GCAGAGCTCTTGAGTATGTCAAACAGCGCCGCATTGGTGTCAACCTGTTGTGCACCCGCCGCCGACTCGGGTCCCAACCCTGCAGCCTGCAATTGGCTCT
GCATCGTGGCGATAAATTGCTTGTAGCCCTCCGGATCCGTCTTCTCCAAGTTGTCCAACCACTGTGCAGCGCAACCACGAGGCGGTGGGAGGGGATTCAT
CAACGATTCCACACACAATTCATCGAGCTTTAATATGCAATGGTAGCGGGTCACGTACGTCAGCGTACTGCTCCATGGCCGCGTCGTCCATCGGGGCATT
CATCTCTGGTGGTTTGAAGAGTCACGAAATGTGGAAATGGCTTTGGATTCGTGATTGAGAGTGGGGACCGAAGCGAGCTGAATAAGTACGATATGACGTT
ATGGAGTGAATATTCCGATAGTGTGGCTGTTCAAAGAGGTGTCGTCAAACACTAGAAAATGACATGAACGAGTGCAAGCTGCCGTCCGTGGAGTGAGTGA
TATAAGCAAGTAAGGGAAGCATGACGCCGTGGATTCGACTCGTTCTTTCATTTTGCCCAGCTCGTTGGGGTTACGACGTGCCCGGGAGCGACTGTCCGTC
TCACCTCAAGCCGAGCGCAAGCTCCCAACAGTAAATTGCAACAGTGGAGACCACCAAAGCCACTTACATGAGGTCCACGAACGGCTGCGCCGCCATGGTG
ATGGGCTTGGTGCCCTTGGTCTTCAGGGTGTAGGCGGCCTTGGGCTGACCGGGGGTACGCTTGATCTGAGCGCGGACGCCGGTGGCGCGAGCCTCTTTCT
TCTTCAGCTCGTTCTCCTTGACGCGCGTGAGGAAGCCCAGACGGCACTTGGACTGGTGCACGTGCTCAATGCGCACGTTGATGTGCTTGTGGATGATGCG
GTTGCCCACGATCTTGTTCACACGCACGCCGACGGCACGCTTGGTCACGTTGAACACGCGGCCGGTACGGCCGTGGTAGAACTTGTGCGGCATGCCCTTC
TGCACGGCACCGTTGGCCTTGATGTCCACGTAGTCGCCCACCTTGAACGTGCGCAGGTACGTCGACATCTTGATCATGCCGCTCTGACGGAACGGGCGCG
CGAACATGTCGCGCGTGCGAGCGCGGTAACCGAAGGAGTGCGGCATCTTTGACTAAACTGCAGCAAGACACGATACATCCATTAGCAACTGAGCTTTCAG
GCATCGTGAGAGCGAGCCGAAGCTTGCGACGTGTAGAGGGGAGCGCTGCATATGCGATCACAGTGGAAACGGTACTGGAAACAGAGGAATCTTTCCGGGA
CGGAGCGTTCTAGACTTTTCCTTCGCTTTGCTTGATCGCCTGTATCTCCGTCACTTTGTACGCTTAGAAGCTCGTCATTGCAGGCGCTTCCGTCCCCGAT
TGATTGATGCATCTGTCCCCACGTGCGTCCCCCACTGTTCATGGCTGCATTGCTCCCCATCGCCCAGAGAGCATGACGCCCCGCTTACCTGCAAAAGTCG
AACGAGACAAGAAGAACTGCGTGAGTCGGCGAGGCTCGGGCGCTGTGGGCCGCGAAACTATTGGCCGCGGAGGCGCCAGCATACAAACACCAAGTATAAC
ACCCCGCGAGCCAATCACCGCGCTTTCACTACGCACTCTACATCTCCTGTAAAGTGCGGAAACGGGTGGGTCGGGTCTCAAACCCGTATTTGCACCTTTT
TGTGTACGATACACAACTTCCCCTTGGTGTACGCGGTGGTTCATATCCGGGACCATGGAGGACGAGGACTTTGGCGAGGATGTGTTGGTGACTACGCAGC
GCGTGGGCGGCGGCGTGAAGGAGGAGGCCAAGACGGAGGAGTCCCGAGCGACGTGGGAGGTCGAAACCGTCAAGAAAGAAGCCGAGAAGGTCGAGGAGGA
CGAGGACGAGGAGCTCTACGGTGGTGTCTCCATCCAGCTCAACGCGTCAGCCACGTCGCAGGCTGAGGCGGCGGCGGCCTCCGCTGCTGCAGGCAATGGT
GTCAAGACCAGCGCTGACCCGGCGGCCGACTCGGAGGACGACGAGGACGACGAGGACGTAGCCATTGTGCTGAGCACAGCCCACGCAGGCGGCAAACCCA
CGCTGCGTTTCACGGGCGGCGGCAATCGCTTCGTGCGCGGCAGCTTCGGCGGTCCGCAGCATGGCGCAACAGGAGCAACAGGAGCTGGAGCTGCGCCAGG
CTCCCACCAGCCAGGAGAGCACGGCGACTCAACGGGGGACGGGGTGGACGACATGGCCATGTTCGGCGGACGACGGACGGCGTTCGATGTGGACATTGAC
CTGCTGGAGGACAGGCCGTGGCGCAAGCCTGGCGTGGACATCTCGGACTACTTTAATTACGGATTTGACGAACACACGTGGAGAGAATATGCAGCGAGAC
AGCTCAGGTTGAGACGGGATCTGGCGATGGAGAAGTCGAGGGAGCAAGCGTCGAGACAAGCTGTGAATGCTGCTAATCAGCAGGCGATGCGCGAGCGAGA
CGCCAAGATGCAGGGCCGCGGGTTCCCAGGACAGATAAAGCCTGAAGGGGACGAACAGAATGGAGCTGGCGTGGGCGCTCCGCCTCGCGGAGGTCCAGGT
GGATTTATGGGGCCACCCCCGCGTGGCTGGCACCCTGGGATGGGCCCGCCCCCAGGCTTCATGGGTCAGCAGAACTGGAATGGCCCCCCGATGGGCGGCG
CACCCTGGGGGTCTGGACCAGGACGAGGGCCTCCTTGGATGGGTGGTCCAGGTGGTGGCCGGGGCCGAGGTGGAGGCCGCGGCGGCTTTGACGAACGTGG
TCGCGGTGGAAAGGATGATCGCGATGACAGGCGGTACGGCGGTGGTAGATCGAGAGAGGCCAGTCGCGATCGCTCAAGATCCCGTTCTCGCCCACGCCGC
GACGACTCGCGAGGCAGTGGGCGTCGGGACGCTGCCGAGAGCAAGGATTCCAGCGAAAAGGATCGAGGTCGCGACCGAGAAAAAGACAAAGACCGGGAAC
GTGGTCGAGACCGTGACCGCGATCGTGAAAGGAGTCGAGCCGGTGGCGAGCGCGAGCGTGACGCTGGTCGTGATCGGGGTCGCGACAGCGGCCGTGAGCG
TGAACGGGATCGTCCTGGTAGTGGTCGCCCACGAGATGGTGGCCGTGGTCGTGAACCAGATCGTGATAGCGGACGCGACCGGGATCGTGGCCGGGATCGT
GAGCAGGCACGACCTCGGGAGCGCGAAGGTCGCGGCGGAGCTGCAGTAGCAGACCAGGAGAAAGAGCAGGCTGGACGAGGCCGAGGAGATCGAAGCGGAC
GCTCGCGATCCCGAGACCGCGACTCTCGTAAACGCAAGAGTCGGGAAGAGAGCTCCGGCGGTAACCGAGGCCCCGGCGGCGGTCAGCGTCGTAGACGACG
GCATTAGACTACAGAAAGAGCAAGCAACCTTCAATTGATGCCTTCCGAGATACCAATCATCTAAACAATGACAAATTGCAGTTATACCTTCATTACCCCG
TGTTGCCTACGAGCTCGCGAAGCATTGTCTAAATCTGCTTGCGCAGCCAGAGCTCGGTCTCGAGCTTGTCCAGGTCCTGTGCTGTCACCTGCATCGCCAT
TACAGCATCGCCCTGGATGGCGTCCACAGGCACGAACGTCATGCCGGGCATGCTGCTCACCTTTCCTCGTGCTGTCACCGTTTCGTGATACGCCTTGGCC
AGTTCCAACTCGCTTGAAAATGCAGTCGCCACGTAGAATGTGCGGACGTGGATCACTCGGTCCCACGGGATAAGCGCCTCCACCAGACTATCTAGCACGC
ACGTCCAGACGCCTTCTGCAACAGCCTTGCCGAGTCCCCGCGTGCTCGTAAACTCTTCGCCATCATTTACTGACGCAGTACAAATAATCTGACAGAGCGC
GCGAGGGACCATAGCGCTTTGCCACTCGAAGGACAAGTTGTTTGCGCTCCTTGTGCGCGTCCAGCTGCGTGGTACCAGGTATTTCAGTGCGACGTGAGTG
AGCGCCTGGAGCTCCACTTCGACTAAAGCGTCTCGTGGAAGACGTGACAATTGCACCACCAGCAACGGCGCTTGCTTCACGAATTCCACCTGCGCCTCAT
TCTTGTCCACATCTTCATCGCTCTCATCGCTGTCTTCAACAAGCTCAAACTCATCCACTAACCCGGCGTTAGTCATGAGGCTGCGGCGGCTGTCGACTAG
CAAACGCTCTCGAGTCTCACGGTCGTCAGGGTCTCCGGTGGTGTAGATGACACCAGAGCACACGTGACGGAGATTCGACTGAAGCGCTTCCAACACGCGG
CAGGCATTGCGAAAGCATTGCGTCGTTTGAACACCAAGGTCACCTGGCACGAGATCCATAGTCTGAGGGTACAGCGCGATCTGTCCGGCCAACAGGATTA
GCGCTCTGTGCAGCACATTAGCTTGGCTGTACGGTCCAATGCAGCATGGCGCCCAGGCGGAGATACTCTTCACATGCAGTACATCGCGGCGCACACGAAG
GGGGAGTAACTTCTGCTCACCGCTGTCCCGCAAGGCGAAGCAGTCCATCAGCAAGCGGGCAGGGACGTCTGCCAGTGCCTTCACTTCGACGCAACTACGA
GATGGCGGCAGACTTTGGCCGAGGTACCGGATGTACTCAGCGTTGAGTTGACCGAAGGCAGCCATGTCCTGAACATATAAGTGCACAAAGCACACATCAG
CCAGCACCATGTTGTGGCTTCCGAGGATAGCCTCCACCTGCGCAACAATGTCTGCCATTTCCTCCTCGAGTGAGATCGATTCATCGCCAGCCTTGCTGCT
CATGATGCCCGAAAGATACAATTGGTCGCGGAATTGGCCCGATGCGGGGATAAATTCTCGCCCAGTCGGCTGCGTGAGTGCCAACACGGTCGCAGGCTTC
GCATCCGTGGGCGCTGCGCTACGTGCGGACGGGGTAGACATCGCCTCTGGGATCCTCGACGCGAGTTGCGAGGGGTCTGACGGCTCCTTGTCCTCCAGGT
GGCACTTGTCAAGCGACAGGAAGGCGACCGGCGCGATGTAGTCGTCCGAGTGCAGCACGGTATGGCTCTCGTCACTGCAAATGCACAACATGTCGTACGA
TCGTAAGGGTACTTTACCAACAGCGAAAAAGCGAGCCAAGTAAACTCACATCACAATTCGCTTCTTGAACAGCGGGCAGTCGAGCGTGAACGTTTCGTAC
TCGCCGCCTTCGCCGCAGACGTTCATCTGGTACTTATCCTTCTACACCAACACAAAAACACCACACCCCAAAAGGCTCAGGAATCAGTACACAATTCAAA
TCCCTCCGCTCCGCTCCACGCGTACCAGCGTCATAAACTGCGGCTGAAGCTCTGCAATGGTCTTGCCCAAGTGCCTGTGCGGCAGCAGCCCAATGGACGC
CACTTTGACGAGGATCGCGTCCATCTCCGAGTCGATCATCTCCTGCAGCAGCTCCGTCTGGTCCCTCCGCCACAAGAACCCGAGCGACGTGAGTCCCAGT
CTGCTGCACACATTTTCCACTCTGTTCCGCTGGTAACTGGAGAAAATGGCGCCCGTGCACACGCCCTGCACGTCCGGGAACTGCTGCTGGACCTTCTGCA
GCAGGCGGAAGAGGTCCTCGACCTCGTCACCCGCCGCCGATTCATAGTAGTCGATATCCGTCCTCACGGCGGTGCCCGTGATGGTCTCCGAGACCAGCGG
CAGCTCCATGCTCTCGGCCACGAGGCGCACGCTCTGGTGGCCCACGCTCTGGAACATGAACGAGTCGATCTCGGCGTCGTCCGCTGACAGCTCCGCCGGC
GGGTGGAGATGCGCCAGACACACGATCTCGTGGCCGAAGCGCACACACTCCATCATGGCATAGCAGCTGTCCTTGCCGCCGCTCACAAGCGCCACCACCT
GCATGGCAATAGTCGATCAGAGCTGGAGTTGCTCGAAGGGAAAGTGACACGCATTTGATGGTCGGCACAAAACGTGTAGCCATCTCATTAATGTGACCAT
CAATCTGTACAGTGTGGTGTACATTGCTGTACTGTGCACCACACCAAGGGTGTTGTGCTGTCGAAGCCGTCATTTGTCCAATAGCGAGTCCCCTTGCCCA
CCGAGATGGCGGCGGCGCGCTCCGAGCTGCTGAGCGACATTCAGAGCGTGCTGAGTCTCGCGCGGCGGCGACATGGCTTTCTGCTGTCTGGGACGTCAGA
CCAGCGCTCAAAACAGGTGCGATATGAAGCGTCTTCTCCTCGAAAACCTCTATTCAAAAAGGTGAAAAGGCGCTAATATTTGCATTATTATGGCAACAGG
AGGGCCCCCTGGCCGTTTTCCAGAGCTTCTCGGTACTACGCGGACGTCTGCTGCGATGCGAGAGTGCGTGCAATTTCTTTTACGCCTCTATACGCTGCGA
AATGCGTTGTTTTAACGCTTTTTCCGCCCCTTTTCACGCAGATATGGCTGAATTGTCGCCCGTGAACGTCGTCAAGCCGTTCCTGGACGTGATCCGCCAC
GAACATGCCAGCAGCACCGTTACAGGTGCCGCTTTGCAAGCCGTAATGAACCTGCTGCGCTCGTGGCCGTGGGCCGACGTCAAGGACCAGAACGCGGCGG
CGGACGCCGTGTCGGACGTCGTCGACGCCGTCAGCCACTGCAGGTTCCAGGAGACGGCCATCGAGAGCGACCAGAACGTGCTGGTGCTGGTCGTGCACGT
GCTGCACGCTGTGGTGCGCTCGCCCTGCGGTGCCAGACTCTCGGACCACTCCATGTGGCAGCTGGTGGAGTCGCTCTACGTGCTCAGTCGCGGCAATCGA
CATGATGTACGTGCTGCTGCTGGTCAATCTGGATCGGGTTGGTGTTGACGACTCACTGTTGTGTGTTTACAGCCCCATATTACGCTGCCGTTGCGATCTA
CAGCTACTAACTTTCTGCATGATACAGTGGCCTTCATCTTTTCTAACGCTGCTATCTATTCAGACTTGGCACCCGCTGCTAAGCCTCTTAGACCAGGATT
CGGGCTGCCGTGTGCGGTGAAGATCGTGGGCTTTCTCTGCCAGAAGCTGCACCAGAGAAACTTCCTGCCCCCTCCTGCCCCAGACGCACCCGTGGGGACT
ACTGGAAATACGACAAGCCGGCGTGAAGGTTTGTTGTCCTTCAGTCTTCTCCAACGCGCGCTGATCGCGTGTGATGCCGAGCTGATTACGAAAGTTCCGT
CGCTGATGCTTTTCATCAAGGACGATCTGTGTAGCGCCATTTTGCGCTACTGCCGTCTAGGGTAGGAACAATGTTGCTTTATGCTCCGCCATTTTTTGTT
GATCTAACTTTCCCAATCCGTGAAATGGTATGAGCAGTGCCTGCGCGGAGCTCAAGGTTACAGTGGTGTGTCTCGAGCTTATCCGGTTGCTCTGGTCGAA
GCTCCGCTCAGACCTGAAGATGCAGGTAGAGGCAATCTTCAATGGCGTGTTCTGCCAGACGCTTCACTGGAGTCTTGCGAACATGGATGTGAACAACCCA
GATTTCCCGCGTGGAGATAACGTGACCCCGCCGGCTGCAGGTGCTAACGGCCAAACAGACGACAAGACTGTTACAGTTGTTGAAGCAGCTCTCGATGAGT
TCTCCGGAGATATGCTGTCCAAAAGCCGATTGTACAATATCTCGTTTGAAATTATGGATTGTTTGGTGGATTTGCTGGCGGAGGCTACGCTGCTGCCCGA
CTTGTACGTAAACTACGACTGCGACGGCAACCGCTGCGACTTGACGCAGAATTTATTCGAGCTCCTTTCTCAGGTAGCACAACAGTCTCATGTTGCATGC
TTTGAATCACACGAAGAAACACATTTCCTGTGGGCCCAGGCTATTGGAGAAATCGCTCTTCGCGGAATGTTCAATGCACTGTACGTCGTTCATCTCCGTA
CGCACCCAGAGCCCCTACCACTGAGTGGTGACAGCAGTGGTCCAAGTGACGAGGAGAATAACGAAGATGCGCTGCTTGTGGATCAGGACGAGCAGCTAGT
ACCTGCTGCTGATGGCGACAGCTTTGCCTCTGCTGACGTATTGTTTAAGAAACGACAGCGCAAGAAGTTTTTCCAGCATGGCATCCAAGAGTTCAACCGT
AAACCATTGGCTGGAATCAAATATTTGCAGCAAAACACGTTCCTGCCTACACCACTCGACAGTATGTCGCTTGCAACGTTCCTGCGATCCCTTCCGCAGG
GCCTCAACAAGAATGCCGTGGGCATGTACTTGGGTGCGATGGGCAAGGAGGTCAAAGGGTTTGAGAAAACCGAGATCCATGAGGCCGACACGATGGATTT
CCACCGCGACGTCCTGACCAACTTCGTTAGATCATTTAACTTTGAGGGTGAGAGTATTGTTACCGCGCTGCGGATGTTTCTCGCGAGCTTCCGCCTTCCT
GGAGAGGCGCAGCAAATCGACCGCATCCTGAACACTTTCTCACTCCAAGTGTACGAACAGTGTCGTGAACGGTTTCTCATGGCATCCGTAGATGTAGCGT
ATCTGCTGTCGTTCAGTCTGATTATGCTGAATACGGATCTGCACAACCCGAATATCCGATCCGACAAGAAAATGAAGCTGATCGACTTCATCAAGAACAA
CAAAAACTATGGCCAGGAGGTTTCCAAGGGCCAAGATTTGCCTGAAGACTTCCTGACTGAGTTGTACAATACCATTGCGAAGGACGAGATTAAGACATTT
GAAGACGGCGGTAAGCACGGCGAAGTGACAAGTGATCGATGGAAGGATTTACTCAACCAGGCAGAAAGCAACCCTCGTAACTCGCGCTTGATCGTACATC
ACCCGTCGCTGCACCTCCGATCATCTAGCACTCCTCGCGGCGTTGGCGTCACGCAAAATGTGTCGTCGCCTCTAGCTCCTGATGTCATGCGAACGATGAA
ACAAGCTCGGCTTACCAAGAGCGCTTCCAGTCCCGCTAATGGGTCTGCTGGTCTGTCCAAGAGGGGAACGTGGGAGCAGCAGGATGGATTCGATGGACTG
GTACCCCTTTATGGCTCTTCAGGCAACCAGTATGATCGCCATATCTTCGAGTTGCTTCAGCAAAGCCTCGTACGAGCTTTTGGCAGTGTGTTCCAGCAGT
TTGTCGTTGATTCACAGGCGAAGGACGCTGCACGAGGCGAGGACCTCTCTGTTGGCAGCAGCTATGAGATGCACTATGTACCGCAGAAAAGTGCGCTCCA
GCTTGCATGCAACGGTTTCGTATTGTGCACGGCAGTGGCATCTCATTTGTCGCTGGTGGAGCACTGCAACGCACTGTTTATCCGCCTTTGCAAATACACG
GCGCTGCTCTCGTCGGATATTTATCCCGTGGGATACAATGGTCGCGAAAACGGCATCTGGGTGTATTGCGACAACCAAAGTGCTCCCGTCGCGACAGCTG
CTGTGCTGAAGCTCGTCAACACATGCAGTTTGTCCCTGCACAGTCGCTCGTGGAAGCATTTCTTCCATGTCATGGGTGGTTTACGTGAATTTCATGTTCT
GCCATCGCGTATTTTGTATCCGAGCGATGAAATGAACCTGGAGCTAATGACGTCCGACGAGCGTCTAGAGTTTATTGACCTGGTGTACCAGAACAAGGAA
GAACTGGAACGGACGATCGCGCTTAGCGCCCAAGATCAGGATGGTGGCAATGGCGATACTGGTGGCTTCTTTAGTGGTGTTGCGTGGCTACTATCAGCCC
TCGACTCGAATCTCGGCGGCTCGGCACCGGACTCATCGACACCAGCGAAGTCGCATCTTTCCCCTGGTTTTGAGCAGTATCAGCTAAGCCCAGCAGAGTT
AGCCTCGCACACGGAAGACCTTGTGATCGAGGGAACGACTCCAAACAAGCAGCCATCCGATGGCGAGAATGACTCGAGAGGAGAGTTCGGAACGGATCGG
TGGATTCGAACCACATTGCAGCCTTACCGCCTTGAATTTTTGATGCAAGATGTCGCAAGCTTGCCATCACGCGCCTTAGCTGAGGTCATTGAGGCGCTGC
ACGACGAGATTTTGCAGGTGCTACAAGGCCCTGACGAGGAGGCGTCTCGAAAAGACCGAAAGAAGTCTACGAAGCTGTCCCTAAGCCAGGGGGGATGTGT
GCTGTTTGAGCACTTACTGAGCCAGGTCATTTCACTGAGCGGCTCCCTCTTCGATGGCGGTCCAGACGATGAAGACGGAATATCTGCTGTGCTGGAAGCG
CATTATACCCAAATGTTGGAGTTCGTACGTCCAGTTTTGCTCACTAATCAAAGCCCGAGCGGGCTGACGTACGAGAACGCGTGCTTCCTATTGCAAAAGT
CAATCAATGGCTTGTTTGCTTGGGTGACGCGTACGCGCAGTGATGCGAACGGGTTGCTGCTCGTAAATTTCCTGAGTACTTTGATGGAGTTGAGCGGTGA
TGACGAGCTCATCCGACCGTTCCTGACGCCAATCATGTGCGGGTTGGATCGATACGTTACTTTGGTGGAACCAAGCAACTTGCGCTACACACGCGTGGAC
TGGTTGACGATCTGCAATTTGATCAGTTGGTCTGTTGGAATGCCGCATGCAGCCTCGCACGCTTTTGGGCTTCTTGAGCGCCTCGTGACCGAGAAGATCT
GGAATGGAGACGGGAACGAAATTCTTATCAGCGATTGCTACACGAAGATGATCATGTTCGCCATGAAAGCCCGCGACCCACATGATACCTGGGCTCCATC
GCGTCCAATCGATCTGCTCCTTTTCATGTTTGACACACTTCGACCTGACGCGCCCAACTATGTGGAGGAACGCTTGCGCTTCTTGGGTGGGATGACTGTT
GTATCGAGGCACTTGCTGCTCAATCAGATTAAGCAGGAGCTTTCCAACGATCTCGTCGTCGCGGCAATCGAAGGATTGAAGCACATGCTACGTGAGCACA
CAGGAACGGAGCAATCGTTTAAACCTGTAGCTTGGCTGGACGTGCTTCGGTACGGACTTGTACCTGTCGGCTTCGACCTGCTAAACGGTGCTGGACCAAA
GCATTCGGGTGGGGGGTTGCATTTCGGAGACGACGAAGAGGAAACAAACTCACCGTTCCTGTATTACCGGAGACAGCTGCCTTCCATTGACGACGAGGGC
TCTTTTCAGCACCCAAATGATGTGTACGCGCGCAGCGATTCTAAGGGGTCAACTGGCCGTCGCCGACGACCATCAACTATGAAAGACCCGCTAGCTCTGA
GACCGCACGTGGTCGTGGTTCAGCTACTATCGCATGTGGTGTGCGAAGAGTTGACAAAGCTGCAGACATGCACCAAGTTTCCTACCGTGTGGGAAGACGT
GGCAGAGCTGCTAGTTGGGTTGCTCGATCACACCGCCATGGAAAGTCCTTCGTCCGCGGCGGATGGAGCTGCGAGTGGGGAAGTGCTTATTGCAGCGCTG
GAGCGTCGTAGCGTTCTGTCGGCTCATGAGGAAATACTCGAGCACAGCAAGGGAATTATGAGGCGCTTAACAGTGCTGCAGGATGAGGAAACAAAACAGG
AGGAAGGTACCCACGACGCTGAAGGAGTTGTTCAGAAGCCGAACGTTTTGATGAGTGCACTGGAAGAGAAGTGCCGTTCACACCCCGACATTTATGAGCA
GCTCTTCGCCTCGAAGGACGATACGGGATCTACTGGCGGACTCACGCCACCAATCGAAGAAGTGGACGGCGAGGCCCCCGAAGAGCAGATGGACAGTGAT
GAGGCGAGCTAAACCGATGCCTTTGTGGGAGGTGGTTGATTAGTGTTTGTTCATAGAGGTATGCAGCTACTAGTGGCGTTGCTCTGGAGCTGATTGCTAT
CGTGGAGTTTAACTGGTCGGTCTAACGGCTGCATTGCCACTCTCTGAAGTCGGTCCGTGTGAATTCAATAGACCCACAGCTTCGTCGGCCTTGGAGTAGA
CGGTCATCAGCTTCTCGGAGAAGCATTGCGTGAACGTCTGCGTCAGCTTGTTGATAATCACGTCCTTGAGATTGGCATCGTTCTGCTCCACGGCGATATC
GCACAGCCGCTCGGTAATGTCGACTAGCAGCCTCAACTGGTGCAAGACAACAACATCATCGCTCAGATCGTGGACACTCAACAGAAGAATCAAGACTGCA
TCGACATACCTGTTGACTGACCCGTGTGACGTTTTCTTCGACCCGCTTCGTCCCAGGGTTCTGCGCTGCGTTTCCGCCTCTCACGCCGGAAAGCGCCTCT
GCATTGCGAACGATGTCAGCCGTGTCGTTGTCCTCTGGGCGCTGCTGTTTGGCGTGACCAGCGACAGCAGCCCGCTTCTCCAAGACCTCAAGGGCCTCCT
TGACGTGTCCTTGGACTATAGCTATCTGCTGCACATTTTCCGTGCAGTTCGCGTTGATGTGCGTCATAATGTGGTCGAGACACTTGTGAGTGTTCTCGAG
CTCCACCGCAAGTTTCTGCGTCTCGGCCTTCGCTGCCAGTCGCTTCTTGTTCGAGTCTTCGATTTCACGCTTCGCCGCAGCGAGATCCTTTGCGCGCTGT
TGAACCTTCTCAGACTCCTGAACGGTAGTGAGGGCGTGCTTCAATGAGGCGACTTCATCGGTGAGACTCTGAACTGTTGCAGCGGTTTGAGACACCTTTT
CGTTGTTTTCATCCCGAAGCTGCTTCACTTGCTGGTCGTTCTCGACATTGCGCTGGTTCACCTCCATGCGCAGGCGGTCGACCTCTTTCTGGAGCCCGCT
TCTTGATTCCAGAAGACTCGTTTTCTCACTGACCAGCGACTGCACGAGCGCCTTTGCCTTCTGACGTTTGTCAGCGTTTTCCTTGTTGATGGTCTCGATC
GATGCCGCTAGCTCTTGATTCTTCTTATCCAGTTGCGCGCAACGTGTTTGCAGCTCCTTCCGAGTCTCTTCGGCTTTCTGGAACTCGGCATTGACCGACT
CGGAGCGTTGGCGGTGCTCCGTGGTGTCCGATTTCAGCGTGCTGTGCTGCGCCTGAAGCTCAGCCATTTCCATGCTCCACTTCTTCATCTCGGCCTTCAG
CGTGGACACCTCGATCTCCTTCTCGGAGATCTTCTCGTTGAGTGTCAAGTTTTGCTTCATCATGTCATCGAGACGCTCCTGAGAGGCCACGAACTGCTGC
CTGATAGTTTGCATCTCGCCGAGCTGCGACTGGGTCTCTGCGATCAAGCTGTCGCTGCGGCTTCTGCCAAGGTTGACCTTCTCGTACAGCTGGGTGATCT
CCGCGAGCTTGTCCTCCAGCTCCGAGCATTTGCTACACGAATACGACGCTACCTCATCGCACTTGGCTTGCAGCTGACTCTGAAGCGAGGCAATATCCGC
TTGAGTTTGGAGCACCTTTGATTCGCTGTCATCCGCTCGGCGGCGGTAGTTGTCCAGCTGCTCAAGCTGGAAATCTTTATCCGATAGCTGCTTCTGGAGG
TGTTGGTTCTCGATCTTGTGCTGCTCAAGTTGGTATTCCAGCTCCTTGATCTTGGTGTGGTCAGCCTCCAGCAGACTGTTCTCGTCGGTTTTCATTTGGG
TCTGCTGAGAACTGAGCGCAGTTTCAAGCGAGCTTTCACGAGCTTTCAAGGAGTCAACTTCCTCTTGCAGGCGACTGCGCTGTTGCTCCGCCGCGACACG
AAGCGCTTCCATGTCCTGGCGGAGGCTCGCAACTTGCTGGGACGACTGCGAAGCCTCTGCTTCTATGCTGCGAAGACGTTCGCGCAAATCTGCCATCTCG
AAGTTCGCCGAGTTTAACTGAGTCTGCAGTGCATTAAACTCGTCGTCAGTGTGGGAGCCTGCAGCCACTGGTTGGGACAGGAAATCCATCTCCTTAGCCT
GGTCAGCAGCGGCCCTGGCAGCTTCTGCAGCCGCAAGAGCTTCAGCCTTTTGCTGCAGCTGGGTCTCAAGGTTGCGGCTTTTCTCTTTCTCAACTTCGAG
CTGCGAGTTCATCGCGTCTGCGAAGGACTTGGCACGCGTCTTGAGGTCGGTCTCGCGCGCCGCGGTCTCTTTCTTCAGCCTCTCAATTTCCTCGGACAGA
CGCTGATGCTCTGCCGAGCCAGAGTCTGCAGGTGCAGCAGCCGAGACTGCAGCGGTTGTTGCCTCCTTCAGCTTTTCCTCCAAAGCCGTGACTTTCTTCG
TCTCGGTCGCAAGTTGGCCGCGCATGTTGTCCACGAACGCCTTGGTCTTGGCCTTGAGAGCGTTCAGAGCCTCCTCTTTCGCGTGCACCTCGCCCTTCAA
CCGCGCAACCTCAGCGGCTGCATCCGGTGGTGCCGCGGCTGCTGTCGGATCCATCGCTTCTTCGTTGCTTTTTGGTCGCGCTTAGCTCGTGTGGGATGGA
GAACTGGTTGGTGGCGGGTTTAGAACTTGCTCAGCCATTGACCGCGCGACAGAAATACACCGCAGGCATGACAGTAATCTGATCCCAAGGCAGGAAGGAC
TCTTTTAGCGTGCGCCATGATGTACTAGGCGGTGTAGTGGAAGTGCCGCATCCATCCTCTGTCGCTACCCCATTTTTAGCGGGCACCTCGTCCTCACCGT
TGCATGCCGTTCCTCAACTATGAGACCATCACTCTCGTTCGCAAATTGAAGTCATTATTTCAAGGTGTCCATTTTAATGATTTCATGTTCCATGATGTGG
TCACACACCAATTAGAATAATGGACGCGAGCGGCGGTTTAGGCGACGTGCACAGCAACGGAGGGGACATCGACTCGCTGCTGTCGAGCGATGCGGACGTG
GAGGGCAAGATGCGGCGGCTGCAGGAGCCGTACGAGCGCCACCGCGCGCACGACCTGCGTGCGGAGTGCTACCGGCGAGGTCTCCGACCCATAAAAAAGG
GTCCGAACGCCAACGATAACAAAAGTGGGTACATTGACTTATTGCGCAAATTCGACGGTACTTCCCAAAATGGGCCTCCGAATGGGCTCCCACCGCTCCG
CGAGGACCAAATGGGGAAGCGAGGCCAGGACGAGGCTCAAGATGACGACGACAGCAACACTGGGGATACTGACCCCCAGATAGTCAACAACATGGCCAAT
AAACGGAAACTTCCAACGATGACGATCCAGACTCAGACTCAGAATGACAATGGAGAGCTACAAGGGTTCTACGAAGGAGCCCAATCTGGTCTCGTGCTGC
CCATGCAGTACCCTCCAAATTTGAAGTCCTCGACCAATCCAACGACGGATCTGGAAATTCTGAGTGGGATCGCCAACTCGTACACTCAAAATGTGGCAGC
CGATGGACAATTGTGCGGTAGCTGTAGGACGGTAGTCACAGAGCAGTTGATGGAGTCCATTCGGCTCGGAAAGACCAAAATGCAATTGCAGGAATGGCAC
AAAATGACGGAGCAACGAGACCGAGATACGCACCATCTGAAAGAGGTGCTGGAGGTTCTGCAGGAGTTGCGGAGAGCTTTTCGAGAGGCGCAGACGACTG
GCATGAACCATGAGTTGCTGGTGGAATTGCAGGACGATATGGCGTTTTTCAGGAATCTCAAGGAACGGACAAAGGAACGGATGCGGCAGGCGATGCAGGA
AGCGCGAGAGCGCGGGAACAAACCCAATGCAACGGCATAATTGCTCACATTTCAATAGGTAAAAGTCGTGTGTGCTTTGCCACATGTACACGTTGCCGTC
TGCAAACTCGATCACTTGTGATTCCAGCAAGAAAAATGATGCTGCGATATAAACACACGAGAGAAACTATCGGTGAAAAATGACAGCGTGGAGTGGTGCT
GAAGACTGCTCGTACGCCGCACGACGCTCGATTCTAGTTTTCCGTCGTTGGGGAGACAAAGAAAAATGGTTGCCTTCTATAAGAGGTGGTTCTGATAACG
GCACGACTGTGGGGATCGCGTGAATTCTGCTGCTGCACGATTCGCTCTCGCGTACATTTGTGAGACTAAAACGATCGTTGAACTTGAACATGTCAATCAT
GGGGTCAATGCCAAAAAGTGTGCAGCCGTGGTGTCCAGCTTCCCAAGGTCTGCTCATTTGCGAATCTGCTCTTGCACGTCTAGCAAGCTTGGATCCACAC
GCTGCCGCGAGTCGATTTTGTGACGCCATGACCGCCATCATCGAAGTAACTACCCCAAGCTACAACCCCGCAGAGTCGCCACCTCGCCGGGAACCAACTG
TTCTGGGGCTGCCGGAACACCCTCCGAGGTTCTCTACGTTCTCGCACCTCGACCTCAGCGACGCTGGCGAGACCAAGCACACGACTGGGTGTTCCGTGCC
CATGCTCGTGTTGCTTTCCCTGCCCCGAATGGCTATCAACATGGCTTGGTCGGCGCAATGGGCTGCTCTCGGTCCATACCTCGGAACGATGCTGCCACCT
TTTGCTGTGCAGCTTACGCAGCTGATCGGTCCACTCTCGGGTATCCTTGTAGCGCCAGCAATCGGCGTCCTCAGTGATCGCAGCTCGTGCAAGTGGGGTC
GTCGCCGTCCATTTTTGATGTATGGAGCCGTGACAAGTGCAGCGTGCTGGATGCTGATGGGATATACACGTGAGTTGGGGGAACTGCTTGGTGACTCGGG
GAACGAGTCTCGTCCGTGCACAGCCTGGCTTACTATCCTGTTCTACACCTGGATGGACATCACGGTAAATGTCGTTCAAACTCCAGCATTCCTCATCATT
GCGGATTTTGCGGGAGACCGACAGACTCTGGGGGCCAGCATCGGACAGGCTAGCTCAACGCTGGGCTCCATCTTGGTGGCCGGGTACATCTACATTTTTG
GTGCCGCCCACCTGACGCTACACTGGTTTCTCGGCATGCTCTCAGCGACCATGCTGGCTTCTGTGGGTGCTGTCTGCGTGTTTGTCAAGGAGCAAGTGCC
CGCTTCAAAGGATTTGGAGGTGGGTCCAGGAGAAGAAGCTCCAAGCGCACTGAAGCGCATTGGCGAAGCATTCTGTTGCACCTTTCACGGCCTCAAGACG
CTGCCCCGTACGCTGGCAATCTATTGCCTTGTGCTTTTCTGCATCCAATTCGGCTTCACAGCCTACAACGGCAACAAGGGGCAATTCTTTGGCATCGAGG
TTGTCGGAGGTAACTCGACGGATGCAGACATCTGTGGTCCGATTCGCTGCACAGCAGCGCAAGAGCGTTACAATCATGGTGTGCAGATTGCTGGTGGCCT
CGCAGACTTGCTGTTTAATGTTCTCGGATATTTGTATTCGTGGATGCTCCCGTTCATGGTTTATCACCTCGGCGCGCGTTGGGTCATCACGGTCGCGTGC
ATCCCGCAGGCTTTACTGATGGTTATGGCGTTCTCGAAGATTGTCGCTCTGGACGTGGCGATCGTCGCCCTCACTGCCATCACCCAGGCTACGATTTTCG
CTCTCATCGTGCCTATCATCGTGCACGTCTTTGGCTGTTCTGCACATGTCGGCATGTATGTCGGTGCAGTGAACTCGGCGAACTGCATTGGCCAACTGCT
CAATTTCCTGGTGGGAGCTGCGCTGGTGGAGACGTCGATGGGGTATGCGTTGCCAGTGTTCGTGGGAGGTGCTCTTTCGTTCCTGGGCGCGGTCATTAGC
CTTGTGGCGCTACGAATTGACATGCGCTCCATGTAAGTAAAGCGCATTGAGGAGTGAACACAAGCTGGTGACGCCTCATCGCCACTTTTTTCTTAACTAG
TTACTTGTTTGACCCACATCTTCGTCTACCCCTCAGTAGTTAGGCATATTTCGACGACCAGTGTACCCCAACGTTGTCCCATGGCTGCGCAGACACAGAA
AGGTTAAGAAAACCAGCTTGATCCACAACAATCTAACATTACTCACTAGTTTTCTGCTAGCAGAGCCTTGGATGCTTGCTTTGTGTAGCTCTCTGGTAGG
TGTCTCTCCGGTGGTCTGCAAAGAGCATAGCGACAGATTAGAAACTGATGTGGATGGATTCGAAGCGGCGAACTCACGGTAGAGCTCCATTAAGGTCTTC
TGCTGCAACGAGTTTGCCAATACCCGCAAGCAAAGATCGACGCGAATCAACACGGCGCCCAGAAAGTGATCCGCTGCTCCCACTCCCACTTAGCGGGGTT
GACAACCCTGGACCCCCTTCCCATGAAGGGGATTGAGCTCGAGCCGAATTTTGACGTACCCCACGCCCTTGCTCATACTGAGCACAGACACCGAACATTG
CGTTAGCGTTGGCATTTATCCGTGTGAAAAATGGCGATGATAACTTACCATCGGTGTCACGTGGCGTTTGTGCTGCGAGTTTTGCCGCGTGCCAAGCACA
TAGTTGTCTTTAGACGTCGCGTCCATCGCTGTTTGGGACGCATACGATCTGTAGATACAGGAAATACGGCGGTAACAGAATATAGAGGTGTGAACACAAT
GTCTGCCTCTTTGCAGCCGGTTCCACTTACGTTTTCCAGTCACTGCAACTGACATCACTCCCAGGTCCAACCTGCAGATAAAGCTGAGACTGAGGTTCCT
TCAGCAGGGAATTTGGTCGGGAGCAACCGTTACCTGGTAAACAGCACTCTGGAAGGGGATACCTGGAACTTGCTCGCCCGATGGACCCTGCTGAGGCTCA
AAGAGCTTCTTTCCTGACGTCATTGAGTTTTCGGCCGAGCCACGCGGCATGATGCCACCTTTCTCGTCGTAGGTTAGATTCTGGTTGGATGAGCACAGCC
GAGTCAATACGTTGCAGCGGACAAACAGAATAGGAATTCGTACATCTTTAACGGACGACTGATTCGTGTAGAAGCGCTTCTTGTACGACCGCCGCACGTA
GCCTCCCCAGTCAGCATCGGGATGGTCAGGATTGTACTTGTCCGCCACATACGGGATGGCAGGTGATGGCCTCTGGTTATTGGACCCGTCTTCGCCTTCA
TGAGGTCGTGTCCCAGCATCAAAGCGTGTCATTTCAGCCTGCGCTTGAAGGAAGCTTTTCTCCATGACCTCCTCTGTTGATGCAATAATCCTCCAGTGTA
TATTCAGGTGTTTCGAGAAGCCTGGGCAGTTTCTTGTGTGACTCGTCGGCGACTAATTTCTTCGAGCTGTTCGGAAACGAGATTCATGTGCTGCTGGACA
TCACTCGAAAATAGTTGAAAGGATGTCCGCATCGATTTCATGACGCCACCAAGAGTCTCGACGCGCTGCTTGACGGAAGCAACTCGCTTGTCATAGTCAA
CGCGACTAAGCTTTGATACCCGTCTATTGTTGCCTGCCTCATCTCGCTCTCCGTTCTGGCTGGCAGAACCGGGTGTAGAGCCTTTGGATTTCCACTCCAT
CGGAGGAAGCTTGTACTTGTCTTGGATTGTAGTGGGGCCTGAGGACTGATTGTCTTCAATCCTCTCTGTTTTTGTGTCGGCTAAGTCTTCTGTAGCCACC
TCGCGCTCGCTCTTTCCATCGCCATTCTCGCACTCATTGCGCTCACTTGGACTGCTTTCAGATTCCGAAGAGACCTCGACAGGAGTCGTAGTCAATAGCC
CTGCCACTTGCAGACGGTTGTCTGCCACCATCAACGAGATCGGATACCGAGGCGCGTGGTCTGGAATAGCATCTGAGAGTGCTGCGGCAACAAGTTTCGA
TAATTCGGTAGGGCTAAAGAGCATAGCGATTCCTTTAATGGTCTTGGCTCGAATCTGCACGCCCATATCAAATTTCACAACGTTAGGTCGGTAAATGGCA
GGCGCAGGTTGATTACCAGCGCCAATAAGTGTGCTCACCATGAATGCCGGGAAGTCAAGTGAGTCTTTTACCGACGGCCAAATCATTCGATAGCGCTTGG
TCAGTCCTTCGCTAGCTCCTGCAATTTTTATCCGCCAAGTTCTCCAGCGCATTTCCGAGATGGTGTAAAACTCGAGCCAGGTATCGTCCGCTGTGTTCGG
TGCAGTAATCTTCGTCGGCTCAGAAATGCTTCGAACGACGTCATGTGTGCCCGACGCTAAGCCTGGATACAACTGCCAGTATCACTTAGATATGAATGAC
AATTTCGATACAGATGCACGACTCAACAAACCTGGACCATCTTCAGCTCGATGATGGAGCTTACTTTATCGCTTTCTTGGACGAGTTTTAACACCTACAG
ATTTCCGCGTCAGCGTCACTTCTTAAATAAAAACCCGGATGAGTTGCAGCCACGTACACTCAATGATCCATCCTGTTTCCCAGCCAGAACAAATTGCTTC
TGCTGATCACCCACACCGGTAATCCACCAACGCATGCTTGTGTATGCACAATTGGTACCAGAGCTAGTTATTGTGTGAACAAGCCGCACGTTTTCGAGAG
GACTGTCGCGCGTGATGACTCCAGAGCGAGTGCACCCCTCGATCTTCAGTCGCTTGCCTCCCAACTTCGGCTGTACTCTTGAAGATATCTCGTGATCATC
CAACAAAAAATCACGAAAGTCCAACAGCGACAGTCGTCCTTCCGCGTCTCCAATAACCAGATATCGACCATCAGGACTGCACTCAGCAGCAACCAGCGCT
TCCGATTGCTGCTTCAGTCGGGCTAGACACATTTGGCGATCACTAAATCGCTCTTTCCAACATAAAACTCCAAACAATTTGCAGCCATCAATAAGAACCA
CCACAGATCCTGTATCGGGCGTCATGTCAAGACGAAATGGCTGCAAACGTCGAATGGCTCCTGCGGAAATCCCCACCACCGGTTCCACGAAACTAAAATG
AACTTGCACCGACGCTGAACCTTGACGAACGTTCTCACCACCCATATCACCGGTATAACGAGAAGCAGAACCTGCGTACAAACGGAACCCAAGCAGCAAA
ATCTCTCGACGACTTTCAACCGCTTCTCCATTTCTCGAAATGTCAGATTCCAGAGCTTCCACGAACGCCCCGACCAGCAGAAAACCGGGAACGGGAAATA
CCACACACGTGGTAACCACAATATTCACATCCAGAGCATCACCGCTGACTTTTTGCCTCTTTGGTGAGCGATTTACGTACTCCCCGATCGAAATTTGCTG
CAGGAACGCAAAGGGATGCGAACTGTTGGCACAGGCGCCGTACAAGTCGATGAAGCGACCGTTAGCGATCACAATTACGCGGGTCCTGTCGCACACTGCA
ATAGTTTGATTGTCACCCGCTTGGAACGCTGCTCCGATGCGTGCAGGGCCATCGATGCACACGTCAACGTCCAGCACCTGCAGCCGATCTTCCGTCATGA
TGCACTTTGTTTTGACCAATTACAGAGCTGAGTTTATTTGGCGAATCAGAATAACTCGCTGGTTTTGTCGAATCAGCGTCGGCTTATGCTGACCAGTCAG
CCTACTGTACTTGACATACAAACATCAAGTCAAAAGTCAAACTGCTCGCGACCACTGCCTCACCGCGTTCACTATCGATTTTGCTTTGTGGACGAGAGGT
TGAATGATAAGCGGTTTTGTGCATTATTATAGCGTTTACAGCGCTGGCGATGGAGTGAAGATACCTAACGTTACATAGTGATAGGAGCGAGGACCGTTTT
GGTCTCTCCTCCTTCTGTGAGCATTACACTTTGTCATAGTTACACTGACCATCCGCCAACCCACCAATATCTGTATATTCCAGTAGTGATCGAGCGCATA
TTGTGCTGCGAGTGGTCGATGCTGAAGAGCGACGATATTTTTCCAGCCAACCTACCCCACAGCACCAACACTGGCCCCCACGACAGTTGTTCTGTTGAGA
ATACCCCAGAAGTGACTTCACTCGATCACTCGTTGTACTGGTGCGCAGTTTTCAAGCCTGGAGAGTGATGAAGCGAAACACAGTACCAACACTGCGACCG
GGGTGCAGTTGTTCTGACTGTCAACGACCGTATCTGACTCCTTCGAATCCTATGGCGTAGTGCTATAGGATGTTAGATCAAGTTGTGAATGGGTGTAGTG
TGCAGCCTCTCCGCAGAACTGATGATTTATCAAGCCCTTGTTTTTTTTTTTTCAAGGGCAGTACCAACTATCTTTTCCAGGAGACCGTTCTGTTGAGACC
ACAGAAATGAAATACACCAGTTTTGGAGTTTTGATCATATCCCAAGGCCAACATCGATTATCATCGGGGGCTACGTGTAGTTGTGTTGAAATTCAGTGGC
TCACGTGCCTCAATCAATTGTTGTAACGTGGAGAATTTGATCTAATGCCCCATGCCTGAGCTAGTACTTCGACTGGAATGTGGCTGCCACGAGGTAAAAG
TGCCGGATCGAACCAGCGACGCTTTCTTCATAAGGTGACCTTGGTGAATTCTTGGCAGCAAGCTGAAAATGTTCCATCCTTCAAGGATACACGTGACTCC
ACTCGTCCCGGCCTCAGCGCGCACAACGCGCACTCCTTGCAGATGCCGAGCGCACAAGTCGTAGAACTCAAGCAGCAGATATTCCGTGCTTTTCTCCTCG
GGTGCTTCAGGAATACTGTTGGTAGAATGATTTGGGTCATGTTGAATATGACTGTGCCGTGCTGTTAGCTTTGGTGTCTCGGACACTCTCGACGTTGGTG
GGTTCTTCATTGCTGCTGCCGCGAAAGGTGCGAGCGTAAATTCGTTTGAAGACCCTGTTGGCCGCAGTGTATGGTGCCCTAGCACCTGGCGAGCTGCACC
AGCCATAGCATAGCTAGTATCAGCAAATTCAGCTCGCAACGAGTCTCCTTTAGCTTTCCACTCGCCAGCAAGTCCTCCTGGGGTCTCTAGCACGTGGGTG
AGTAGTTCAAGCCACTGCGGTGATAAGACACTGCGAAGCCACTGGTTCTCCCGAAGTGCGGCCCCCAAGTTTGTAAACGCCCACGCTGAGCTCAGCTGTT
GCGAGTGTCTGAGCGCGTAGGCGACACGATGAAGCGACTTGATCAGCAAATGCTGGCTGCTCTCAGCGTTAGAGCTTTCGCTTTGAGAATTATGCAGATT
GTCGTGCTGATTATTTGGCTGTGTTGATGCCGATTGACGTCGTTGGTTCAGCACCACCGACTTCTTTTTCTTCTGCTCACGCTCGGCCTTGACTTGTGCG
ATATACTCCGCGTCCTCGCGTTCATGAGCCAGGTCCGCTTCGAGTTGATACGCGACCTGGGAGATAATTTGAGCCCACGCCTGCCGATTCAGCCGCAGGT
CCATTTGAGTTCGACAGGACCAATGGGAACCAAGATTGAGATTCTTGGCTACCAAGAGGGCCTCAAGTGAATGGCTGCACAACCAGCGCAGCGAAAATCG
CTGCAAAAGGTGGTCAAACTGCATGGACGACGGCAAACCTAGCGACTGCATCACATGATACAAATCCATCTCTCCAGTGAACAGGATCACCAGTCGAACT
ACTGGCGATGACGGTCCAGGAGTTCCACTGCTTGATGGCCCCATGCGTAACTGGGGTTTCGTCGGTAGTGTAACAAACCAACGGTGGAAGAACGGTAGCG
ACTCGATATGATCGCGAAAAAAATCGCCCAAGAACCATGTTAAACGATCGACTAGAATTTGAGCGTCGCTGTCTACAGTAAGATAGCCACATACAAACTA
ATTAGATTTTTCCTGTACGGTTGCCAGTACCAGCAAATGTACCAACCTTTCGTGCCACTCCGACAGGCGAAGTCGATGTACATGAAGCATTCTGCACCAC
GCTCCAGATATTTCAACTCGTGGAGTGTGGCAGCAGCTGCACATTGCATAGTGTATCTGGTTAGGTCAGCTCCCAACTCAAAACAACAAAAATCACTTAC
AGTCAGCGTCCGAGTTGTAAGTGAGATGAACGGTAGCGGTTGTAGAAAACTTGTGCCCTACGTCAACTTTCACCATATAGTCGCCTCGATCGCCGCCAGG
AGTGCGAGACAGCAGACAACTCGCAGACAGCAGCCCTGTGGCCGCTGCTTGGCGCACATGTTTAAATATCCATTGAACTCGTTGCTTGAGTCGTCTCAAT
GCGCAGAAGGAATGCAAACGGCACTGCAAAAAGAATCTACGCCAGCGCTTCACCACACCCACGTCTCTATCAGCACAGAACCAGCTTCCAAGTAGCAGAA
AACGCAATGACTAATCACGTACCTACCGTTTTCACAGCCGGACACCAGGAAGAGGACATCAAGCTCAGAAACCCAACCTTGCAGATTCGTGGCTGTTCCT
CATTGTGCTCACTTCGAGCATGCCCTTCATTCGTGAATCGTAGAGCCGACTTCTGACGGTATCCAAACAAACGCAAAGTACGCTTCAATTGATGTATAAA
CCTCAGACAACGTGCGAGTTCGTATCTCTTGGCAATGATCTCCGCCGTCTCGTCGCCCGTTAGGACAAACCCACTCTCGGCTAGCAAATACTGCGCAGCT
TTAGCCGTCACTGAACCCGTCGGATCATCCGCATACGCGTCAAAAAGCTGTTTCATCGTCTCCACTCGCTCGAGCTCTTCCCACTCCAACGAAATCCCCA
ACGACGCCAAATCTCGTGTCAACGGCTGTTCGTCCTCAATCTGCTCTCGGTACATGACAAACCCTTGGAACGTAAGCCTCCCTTCCTCGTCCAGCTCGCA
CATATCACTCATATACATTCCCCAGACCTCTGCGCTCTCTTCAAACGCCCTCAACTCCACCGAATCGCTCGAGCACTGCAACGCCGCCATGTACTCCAGG
AACTCTTCATGTGTCCACCTTTCGTCCTCATCTGCGTCAAAAAGGGTCCAAATCTTCCGACACTTGGCTTCTCCCAACGGCGACAGTCTCCACTCAAGTC
GAACTGCATCCGGAGCGTCGAAATCAAAGCGAAACGCTGCATAACTCGTCAAACTCGCCACAGTCCGTCGGAACAAGGAAGTGGTCGGGTTCCAATGGGT
AGCGGGCGACTCCAATAGGTACGCGCTATTGTATCCATGCGTGACAGCTCCAGCCTCCCTCAGAGAGTTCTCCACCGCCCTTAAACTGGATCGGATCTCG
TCTCTGCGCTCCAGAATCGCCGCCTCATTCGCGGCCAGCGCCTCTTCCTCCATATTGATACAAAATGTAGCCATCTGTAGTTGAAGCGGTGCGATCTTTC
ATTTTATTGGTAGAAAAGAGATGGATTTCCAACCAATTAAAAGGATTTCATTTGGTGGAACAAGGGGAGAATTTGATTCACTTGGGACCTGATGGACGAG
GCGAGTAAGGCGACGCTGTTCAACGCGCTGGCGTGGGTGGACACGCTCAAGACGCGTGAAGGCGTGGATGCACAGGAGATCGACACGGCGCTCTCCCGTC
TCACGTAATTTCAGCATTTTGCTTGGTCCTACAAGCTGCAAAATCTCGATATGACGTGTTTTTCTAACGTAACATTTTACTTTTTTATTATTATTTACCA
CATAGTGAGGCTTTCGGCGTGGACGTGCACGACGCCGAGCAGCGACGACAGCTGGCGGTCGATGGCGACGCCTCATTCGACGAGATTTTTGCTGCGGGGC
TCAAGGCGCTGAACCTGGAGACTGGCGCGAAGGAGGCTGTGGACGAAGATCCTGTCGTTAAAAAGCGTACGTGGATGATTTTTATAAGAGAAGGAGGAGA
GCGCTGATTGGCTGCTTCTTTTCTTATTTGTCAGACCCGGAGCTCTGGAAGAAGTGGGTGGCCAAGCTGGAAGCCAAGGGTTTCTTCAAGGACGCGGCCC
CTGGCACCAGTGAACATGCTACCCGTACGGCCAAAGCGCTGGGTAAATTTAAGGAGAAATTCGGAGATGTGAAGCCGGAGCTTTCCCAGGAGGAGAAGGA
GGCCAAGGCGGAGGAGGTGAAGGCCCAGGGCAATGCGGCTCTGAGTCGCCAGGACTACGAAGGAGCTGCCAAGTTGTATCGAGAGGCGCTGCAGCTGTCA
CCAGAGGGACCGTCGTCGCACATTTACCACTCGAACTTGGCTGCGGCGTTGATGTACCTGGGCAAGTACACGGACGTGATCGACCACTGCGAGCAGTCGA
TTGTGCTCAAGCCGGCGTACGTCAAGGCCTACTCCCGGTTGGGCAGCGCGCAGCTGCAGCTGCAGGACTTTGACGGCGCTATCGACTCGTTCCGTCGTGG
ACTTGAGGTGGACAGCTCCAACGCTGCTTGCCGTGACGGCCTTGCAGATGCTGAGCGCAAGCGCCGCCAAGTGCAGACGACGAGTTCTTCGTCAGCTACA
CCCCCTGCTGGTGGCGCTGGTGGCATGCCGGACCTGTCGAACCTGGCCAGCATGCTGGGCGGAGGTGGCGGTGGCCTCGGCGACCTCATGAACAACCCGC
AGATGATGCAGATGGCCCAAAGCATGATGCAGAACCCGCAGATGATGCAGATGGCGCAGAATATGATGCAGAACCCCGACATGCTCAGCGGCCTCATGGG
CGGCCTTGGCGGCGGTGGTGCTGGCGGTGCAGCTCCCTCTGGCCCTGGTGCTGGTGGCATGCCCGACATGAGCGGCCTCATGAACAGCCCTGAGCTCGTG
GCGGCGCGATCCGACCCGGACCTGGCAGATTTCTTCCGCGACGTGGACGCCGAAGGCCCGTCGGCCGCTATGCGCCACATGTCGAACCCCAAGGTCTCGC
AGCTCATGCAGAGCGTGATGGCTGGGATGCAAGGTTAGACAGGACAGCAAGCAATAGCGACGCAGCCGTTCTACTGCTTGCAGACGATACGAGGACTGTA
AATGGCAAGTGGTGAGTGAGGCTCTAACTGTTTATTGTGTGCGGTGTGGTCGTCACGAACCTCAAGCAGCCTGTACGGTATGCAGCAATACGGGTTTAGT
GCTTGACGAAGCTCTCGGCGTCCTGGAGGAAGGTCAGGTACTCGCGCTGCTCCTTGAGATCAGCAAACTGCGCGATGAACTGCGCCAGCTCGTCGTCGAT
CTTGCGCTCGGCCAGGTAGCCGTAGAACTTGTCCTGCACGTCGAGCTCCAGGTCGATGAAGTTGGGCCCAAAGTACAGCGTCTCGTCCTCCGCGTCCTTG
GCAAAGTCGCTCAGGTAGCGCACGCGCTCCACCGTGAGGTTGCTGCTGGCCACGCAGTCGAACTGCAGGCCCTTGTTGTCACGGGTCACGTCGGCCGTGA
AGCGGACGCCCGGGAGCTCGTCCTCCTCCTCTTCGTCTTCGTCCTGCTCCTGCTCGTCGTCCTGCTCATCGTCCTCATCCTCGTCGTAGTCCTCGTCGTC
TTCGAGCTCCACAGTGTCCTGGGCATTAAACTTGATCCTGATGGACTCGGAATCCACCGAGCCCTCGAGCAGGACGTCCATGCAGCCAGGAGTCTCCTTG
AGGGCGAACACCTCCTCCACCTTGAGACGCAGAGCCTCCAGATCGGGCTCCTCGAAGCAGTTGGCCTTCTCCTCGGTCACTTCGCGCTGCAATAGGAAAG
AAGTAGGTAGTTTTAGGTTAGAACGCGGTTTTTACTGGATTGCGAGCGGAATTTTACGAGTTGCATGACGTACGTTGAGAATGGACACGAGCGTCGACTT
CTCGCGGGTCTGCAGGGCACGCAGCGCCACAGAGGGCGTGCGGCGTACGGCGGCGAATGAAGCAGCGCGAGCAACTCGGGCGAACATGATCTCGTCCTGG
AAGATTTGAGAGTGCGGTGGAGCAGCTTGGCCACATACTAGATGGCGTGTGATTGGCGGAAAAGAATGGGTTTCAGCGAATGAGGAGAGCGAAGGGCACG
CTGCGGTGCCCCATTTTCAAGAAGAACTCACACTTTGGCT