Description :
From Genome Similarity Track
Location :
Scaffold_240:40622- 41692
Transcript NameFunction/comments
Phymu_g7377hypothetical protein

Sequence
1070 bases(100 bases per row)
TCCGCCATGTTATCCACCCAGCCCCATGCGATGACTGAGATGCGGCCTTCTTCCCGCACGGGAACGTCCTGCAGGATGCCGTGGCGCCAGATCACGTTTG
TATCCTTCGAGAAGGCGTAGACGCATCCGTCGGGTTGCGGCACActcaccaccgtcttggtCTCAGCGTGTTCGAAGGCGACGTCGCGGGTAGCGCCGAA
CGAAATGGCGACCGTGAAGTTCTGGATGGCCGCAATGTGAGGCTTGACGGCCGCAGCGTCGAAGTGGAACGGTTTCCACTGCGAAGTGTCCTTGTACCAG
TTGAAACGCGTGGCCTTAATGTCCAAGCTGAAAAATTCCTTCAAGCGGTCCGTCACGAGGTCGAACGTGGGGCACTTGGCCTTCCAACTCGAGTGGTCAT
CCACAATGAGGTGCGTGCCGTCGatcttgttgttgccgtgCCACATCTTGAGAAGTTGCTCGCGCGGAATGCCACAGTTGTCGAGCTCGTGCATGAGCTT
CGTGTAGAGCTCGCCCTTTTTGAAATCGCTGAAGAGGTTGGGCACGAGCACCACGTCACGAGAGGCCAGTGGGGTGGAGAATTTGTCGTCCTTGGAGCCC
AGATCGTAGGTGAGGCGCAGATCCACGGGCTTTGTCATGGGTTCGAAGCTCTCCGTGTTCTTCTTATTGGCCTGACGTCTCTcgttcttctttttcttct
tggccttcttgtcaCTGTCCTGTTTGTCCGCATCCTTGGGggtcgtctcctccttgtcgTTCGATTTtacctccttctccttgggcttcttgtcCTTTGG
CTTCCTGGTCTTcggcttctttttcttgtctggatcctcttcatccttAGCAGCgatttcctcctccttggcaTCCGGATCGGGTAGTGTGACAacgtgc
ttcttgttgcacTCAGCGCCAAACTTGCACTGACCCGTCCGCCAGAAGTGCGGGCACAGCTGCTTGTCGTGCACGAACTTGCAGCCAACACGCGTGCACT
TTCTGTTACGCATAAAGGTGCGGCATACGCTCTTGAACAGTCCGGCCTCATCCTCGAAgtgcagcggctt