Description :
From Genome Similarity Track
Location :
Scaffold_13:40617- 43009
Transcript NameFunction/comments
Phyra_75442arginine biosynthesis bifunctional protein argJ puta
Phyra_75443Hypothetical protein

Sequence
2392 bases(100 bases per row)
CAGTCCAGCGCCCCCGCATCCACTCGCAACTGAACAAGTTGTTTGCTCCAATCAAGTTCATGGCGATAATTCACACCTACTCTACGCCAGCTTACGAGCG
GTAGTCGGCATTGATGGCCACGTACTCGTGCGTAAGGTCAATGCCCAGCACTTGAGTCTCCTCTGAACCAACGCCAAGGTCAATCTCCATCTAGTCCAAC
AATGAGAACAGAACAACGTTTAGAATAAGCAACCCATCAGAATACGAAAAGCGCTTACCTCGACAAACTTTCCGTGTGGCGGGAAGTTGTGCGAGCTGGC
ATCGAGGCCGCCACGAGTGGGCTCGATCAGCATCGCATCGCGCATGTGCTCCACAAGCTTGGCCTCAATCTCGTCGTTGAGCACCATCTCACCGTTCTCG
AAGATAATAACGCCACCCATGTGAATCTTCATGCGACGTGTGATATCCACGTCCTTGTGGTGCAAGCCCATGTACTTCCCCACCGCCATGACCAAACGGC
CCACGTTCGGGTCATTGCCAGCGACGGCACACTTCAGGAGAGGCGAATTTACGACCGACTTGCCGACACCCTTCGCCATCTCCTTGGACAGAGCGCCACG
CACGCGCACCCGCATCACGTGGTGTGCACCCTCGCCGTTTCGCACAATATCCTCGCTGAGTCCCAGACACACCTCGTGCAGCGCCTTCTTGAACTCATCT
AGCTGGCTCATGTCGAAGGGGATTTGGTCCGAGGACACGAGAGTCACCGTGTCCGACGTGCTCTGGTCCGTGTCAATGCTGAGAGAGTTGTACGTGTCGC
CAACCACCTCCGTCAGCAGCTGACGCAGCACGTCACGAGGGATCGACAGATCTACATCAAAAGCCACAGAAAAGTCAGTACAAGTCGAACACGTTAATCC
TGAACAGCCAGGACGCACCGGTGAGGATGTAGGACAGCATCGTAGCCATGTTGGGCTCAATCATGCCAGCACCCTTGGCAATGCCGACGATGCGTCCGCC
GCACACGTCCATGGAGCGGATCTTCGGATACAAGTCTGTCAACAAGCAGCAAAACAATCAGTTAACAATCTACGAAACCTCTATAAAAACCAGCTAATGC
TTACCTGTCGTCATGATTCCCTCGGCAGCAGGCAGCACCGAGTCGGACTGCAGGCTGTTGACGAGCTTGGGGAGGTTCTCCACCATGGCTTCCACGGGAA
TGCGCCATCCGATGACGCCCGTGGAGCAGGGCAGCACCTGAGCGCCGCCCTCCAGCCGCAGGTGCTTGGCCAGGCTCTCGCAGACCTCTTCGGCGTCTGC
AACGCCGCCGCCACTGGCGCACACGTTGGAGATCTTGTTGTTGACGAGGATGGCGCCCAGCGTGGGCTCGTGCAGCCGCTTGCGCCCCACGAGCACGGGC
GCCCCGGGGAAGGCGTTCTGCGTGAAGACGGCGGCGAAAAGCGACGTGGGTTGCACAGGCTTGATGAGCGTCAAGGTCATGGTGGCCGGCAGGTGGGGCG
CCTCTCGCGGGATGAAGTCCAGCTTGGTGGTGCCCACGGAGAAGCCCCAGGGCAGGCGGCTTTGGTGCGTCTGCAGGTAGTCGGTGTATTCGTGGCGCGA
TTCGAATACGAACGGGTGGCCGTGGGTGGACAGGCAGCGAGCCTGCAGCAGCGCGCGCGGACGCGAGAGCGATGACATGCGAAGGAGCGACATGGCGACG
AATGCACTCGGGGGGACGCCGCTTTTCGTCTTGTGGGCCAGTGAACCAAAGATCGCCAGATATTAGTCCAAGTACGTGGCCGATTGACGCAAAATTTGGC
CCCAACGTACCAAATCATATAATTTTGCTCCCATCGTCCAATATGATCGACGGAAACGAGTCGGAGGCCGGCTCGGACGCGCCGCCGCCACCTCCGCCGC
CTCCTCCTCCCCCGCAGTCGCGTCCTGCGCAGCCGCTCAAGCCCAAGAAGAAGAAGGACTTCCGAGAGATTCTAACGCTATTCCACGAGGAGGAACAGCC
GGACGCCACCACGACCAAACGCGTCTGGGCGGCGCTGTGGCAGACGACGCTGGCGGAAGCGCAGGACGAGCACAAGCGGCGGCGGCAGCAGGAGCAGCAC
GGACTTAAGCGCAAGAAAGGGGGCGAGCATGACCATACGCCAATGAGAGGAGCGCCAGGATCGCTCTCGAGACACGGCAGCATGGTCCAGGACCACCTCA
AACGAGCACGACAGGTGCAGATTCTATTGCTATGCTTTCCGGGATTTTTAAACGCGTTTTTCACGAATTGTTGTGTTTTTAGGGCTCTTCGGCGAGCACG
GACTCATCCGAGTCCATCAAGGCTGGGAGACTGGGCGGTAGGTTCCCCAAGAACGCCCCGAAGGGGTCCAAACTCCTGCAGAAGTTTGGCGG