Description :
From Genome Similarity Track
Location :
scaffold_6:40612- 49409
Transcript NameFunction/comments
g385.t1 hypothetical protein PHYSODRAFT_262149
g386.t1 hypothetical protein PHYSODRAFT_508739
g387.t1 2-oxoglutarate dehydrogenase E1 component, putative
g388.t1 conserved hypothetical protein

Sequence
8797 bases(100 bases per row)
GCTGCGAGATGGCACGCGCACGGCCGTGAAGATCCCCGATGGGTGTCTGCTTGTTCAAGCTGGCAAGCAGATGGAGTATCTAACGGGAGGATACGTGCAG
GCGGGCTTCCACGAGGTTGTGGTGGCGGAGTCGACTCTCGAAACTATCGCCCAGCGCAAGAGTGCTGGCAAAAGTCTTTGGCGCGTTTCGTCCACCCTCT
TCTCGCACACTGCATCTGACAAAACTCTGGAGCCTTTGGGTCACTTTGCAACGGCTGAGACCCTAGCTAAGTATCCTCCTATTCTCGCGGGCAACCAAGT
GCTGGAGGAGCTCTCGCAGATTGAACTTGGCACGGGCTTCACCCTCCATCGCGAGTAGCTTCGGGTGCCGAGTTGTTATTCACTTTGAAGTAGTGAGTAC
GAAGAAGTATGACTTTCAAACGCAAGTCGGGTTGTTTGTTCCTTATAAATCGAGCATGCAACTATCAGATTGCCTAGGCGTTACCCGGTGTATATGACCT
GCTCAAAAAAAGGAACGTATGTAAGTATCGTTAGCTTCCTGTTTGAAAAAAGGAGCTCATACCGATCCAGGGGGTACCACGCCATTTTCACTGTCATGGA
GCAAGCAAAGACTTGCAACTTCGAGACGTTTGCCTTGGACTGTGCTGAGCAGTTGCTGGCCTCGGTATGTACTGGATGTGGATCCATGAGACTTGCGCAC
GACAGCTACGGAATTCGTTGAGAAAACCTTCTTGCCGTGCATATCCAAAGTTTGCGCATGCTTCATGTCCACCTTCAGGTTTTTCATTCGCTGCTCTTCC
CTGAAAATTTGTTCAACAAAAAAGCAAAGGCTCAATATACCAATCATGTCCACCAAAACATCAGACACTTACGTCTTTCTGTGAGTTTCGTTTGCTCTCA
CGACCACGTAGCGCTTCTCCATCAACTTCTCTCTGGCTTCTGCAAGTTCTTCCTGTTGCTTCTCCAATAGAAGAGCTCGCTTCTTTTCTTTGAACTTCTC
AAATTTTACCGTATTGAGCACTCTCTGATCCCGTTCTAAGCTGTCTGCACGGATGGAAACGTTCTTGGCATCCTCAAACAACTTTAGTTTGGCCAGATTC
TTCTCAGTGTTTTTGAGCTCAAGCAGCAGCGTGGAAAATTTGACATGGGGCTCTTGCAGCTTGTTCAGGTATGTTTCAAGCTGTGCTCGCTCCACTTCAT
GCGTCTTCCTCAGTTCTTCTTGTTGGTGCAAGATTTCACGCTCACAAGAGTCTGTTCGGGCTGCACATACCACATCATTACGTTGTTTTGCAAGTACAAT
TCCGCGACTAAATTGTTGTTCTTCTTCCTCCTGTCGTCGGTTTTCATATATTCCCTGCATCTCGACGAATTCGCGCTTGATCAGGCGCAATCGGTCGCGT
AGCACGATCGCCTTGTCATATTTCTTGGTTTTCATTGACAGATCACAAAGCAGATCCTCCAGTTCAGAGCGAATCTTCTTGAAGATCGTACATTGATCAT
GCTTGTCGATGATATCTTCTGCCGAGTAGCCAAAGACTGCGAAAACATCTACCAACGACTTGATGTCCATCGGGTTCTTCTTCGATCCTGCAGGGGTTTT
CGAATCGAGAACAGTAAGCTGTTCAGCTTTCATAATGGCGAACTGCAGATCATCACGCAACTGTCGAACAAAAGAGGTCAGATTATAAGTGTAGAAGTTT
ATATGCACTTTACATTGAAGTACCTGTTGCTTCTGGTCTTCATTCATGGCCACCTACAGGAGGTTGGAAGCAGATCCACAAAACGAATGAAGGGGAGAAC
AGAGTTTAAATAAAGGTCAAGTTTCACCTCACTAAAAATATGAAGTGCTGGGACTAAAATTGAACTAAACGTTCACGCACTGCACTGGAACATGCCGAAG
CTTATGCTCCCGGGGTAACACGTTCATGAATTCGAACGGCAAGTGGTCCCTTGACTGGGAGCACGAAGGAGAAGTCGTAGGTGATTTTAAACGGGTCTTC
CACCGTCTCAATGTCGAAGCGACTGAAGAGAACAGCCATGACAGTCTTCATCTCCAGCATAGCAAGACGCATGCCAATGCACTTGCGTGGGCCCGTGCTG
AAGGTGATAAACTGCGGAGGTGTGATCTTCTTGGGCTCTCCGGTTTTCTCGTCAAACCAGCGCTCAGGTCTGTACTCCGCGGCATCTTTCCCCCATACGT
TTTGGCGTCGCGCTGCAGCGTATTTCGATACGACCACTATAGTCCCTTTCTTGATGAACCCTCCGTCCGTCAGTGTCGTGTCTCGAGTTGTGCACCGATA
CGTGGAAACAGACCAGAGACGCACGCTCTCCTTCACTGCAGCGTCCAAGTACACGAGCTTCTGCGTGTCTTCACGTGTTGGGGCCTCCATTTCTCCAGTC
AGAAGCTCTGGAAGCACTGCTCGGATCTCCTCGCGAATCTTCTGAAGAACGCGAGGGTGGCGGTTCATCATCACAATGAGCCAAGACAAACTGAAGGACG
TCGTGTCCTTCCCAGCGATGAAGAAATTGACTGCCGTATCCTGGAGCTCGCGCGGATCGGCATTCAAATTTTCTTTCATCAGTAGCGTCAGTAGGTTCTT
CCTCTCAGCATCAGGAGTCTTCTCAGTGATGGATCGAACCATAATGTCGCGCACCATGTTGTTGACGATCTCCATGTTGTCCCGAAGACGCTTTTCAGCG
CCGATATTGAGGAACCGAGTGAATTTCCACATCCACATGGGGGTCTGAAACCGGTTCTGAACCGCGTGTAGTGCGATGTCCAGCGGGTGCATTTCGTCCA
CGAGGACGTCCCCACCGAGTTGATTGAGCTCCACACCAAACCCGATGCGAGTGAACACATCACTCGTGAATTTCCCCAATAGCGACTTCATGCTCACGGT
TTGGTCTTGATTGGCACATTTTGCGAGGACATCTCGAAGTTGCAGCGTTTTTTCTTGAATCACCGGCTCCATGACTTCACGAATGCTGTTAGTCGAGAAG
AGATGACTGGCAGCTCGACGTTGCTGTTTCCACTTGTCTCCGTTGACGTTGAGCAGTCCGTTGCCCAACACATCGAACGAGATATCACCGAGTGTGCCTC
CTTTCTCGAAGACATCGAACTTGTCCACGAATACGTCGTTGAGGTCGTTGGGCATGGTGAGCACGACCCAGGGAGGTTGGAAGAGCAGCTGAAGGATCCA
TGGCTGGCCTCCACTTGCGTCTGTCTGGTCGTTAATCCAGTCACTCATCCGGTAGCGGTTGAAGAGCAACACGTCCAAGGTGTTGCCCAGAATTGGCAGC
GTCGAAGCCGGACGGAAAAGCTCCATGCCCGGGTCAGGAAGTGGAACAGGCATGTTCAGGAGCTTCCACGACGCGTAAAAGGCGGTTAAGGCACCGAGTG
CCAGCAGTGCAGACTGCTGCGTTCCGTCGTGACTTGAACTCGACCACATTTGAAGTTGTCGTCAGAAGGTTGAGAGCTGGTTGTGTTGCTTGTGCCGTTG
AGAGCGAATTTGAATATGGCGAAGAGAATTGAGAGCTCAAGTTGCTAATGAAGTCCCTGTTTGTTTGTTGCTCTCGAGTGCGACAAACTTCGGAAGACCA
ATTCCATGATGACTCGAGTACAAAGTGAACCGGTGATTGCACCAGGAAACCTCAAGGACAAGTCCCTATTGAAAATTTACACTGTTGCTGTCAAATAGAC
GACTGGTGGAATGTACCTGGATCAGAACCCTACAACGAAGCGACACTTCCCGGATCCGAAGTACCATGGGGAATCTGTGGAGCTACTATGCAGGGGGCAG
CGATATATTCGACAAGACCGCGTGCTTGTCATCGGGAGGAGCATCACACGCCTCTGCATTCTACACGTCGTTCAGACGTAGCGCCGCCAAGGTTGTGCTA
CAGCAGGAGGCGTCTGGACTGACTTCGGAGCGGGAAGAAGTGCTGCTGACGCTGGAAAACTGGATCAGCGAGGTGTCCATATTGTACGACCAGGACGAAG
AGTTTCCAGTGTCGGTAGTAATGCAGCAAGAACTGGTGTTTGACCCAAGCAAAACTGGAGATTTGACCGATCTAAACGCTTCGAAAGACGGCGAAAGTGT
GCCAGCCACACTGGAGGAGAACATCCTCAAAGGCTTAAGCTCCAACCCGTTAAGTACGCCCGACAGTATCTACAAAATAATGGTTCAGCTTGGCAAACGG
CTCAGTGGCGACGAGTTTCTGCGCGTGGTGGGTAAATACCCGCGTGCTGCACGTTTGTTTGCAAGTCAACTGCTCATTGCACGCTCCGACGTGTTCAATA
CGTTCCAGATGGGAGTACTAGTGGGAGATTACAATCAAGCTGCAACAGTGGTGGGGAAGGCTGCGTACGGGGACAGTGTGCTTGATACCAAACGCACTCG
GCTGAAAGAGGCGGCAAAACTCTTCCGAGCATCATTGAACACCGCGTCGCCTTCGATCACAGCGGCTCTGTCACTAAGTTCGGCTGAGCTACATGAACAT
TGTGTAGCTCGATCTGCAGACTCCTTCAACCTAGTGATGACGAGTGAGATGCTGCAGTTAATTGAGACGCAGAGAGCCATGGAGCGCACTTTAGCGATTC
CCGCGGGGCTTCTTGTGGGTAGTTCGCTGATGGAAACTCTCCAGAAGGTGATCACACTCAACCCAGTTCATCGTCAAGCGCTAGTACTGGCAGTGGACTG
TGCTGAGCAATACTCCGTGCCTCCTCGACAGTTTTGGTGGACATTATTGCGTGTGCTGGCAAGAACCGATCAATGGGAGACGCTGTTAGCTTTGGCTGGA
GCCATTCGCCCTCCCATCGGGTATATTCCAATCATAGAGGTAATGCTGGACGAGGACAAGCATGATCTAGTACAGCACCTGCTGCCTGTCATACAAGATG
AGGACGAACGCGAACAAGTCATGTCATTGCTGACAGAGGAACAACAGGAAGAAGACGCAGAAGACCAGGAGCCGCATCAACTTGACACGCTGTAGCCATT
TTTGCAGCACTTCAACTGGCAAAATGTCATATGATCGCCCTTTCTTTGCCTGTTTTGTCTTCAACGTCCGGTTTTATCTTGCTTTTTGTATGCCTTCGTC
CACGTCCAATCCGGCGTTTGGATTTCGGTATCCCCATCACAAAAGCCTACAGTATATAGGACCTCATTGACACCATTCGGCATTCCTCCAGGCCCTCCGC
ACTCGACTCGTGTTTGTCTCCATGCTGCGTCTTCCCGGTCTCTTGACGCGCCACCGCGTCGCCCCAACGAATGCGCGTGCTGTGCTGCCCAAGGCGCTTT
TCTCTTCAGCCTCGTCGCTCGAGTCTCTGGCCGCGCAGTCCATGGCCACGGCCTTCCGCCAATCCGGGCATCTGCAGGCCGATCTAGACCCACTCAAGCT
CCAGCAACGCTCGGCTGTCCCTAGTCTTGCAGCTGACAACTTCAAGCCGCTGCTGACTCGCCCTCTCGCAGCTACAGACCTGGCAGATGTGGTGTCGGTT
GCTGCGGCCAATGGTCAACAGCTCTACGACGAACTGCACCGCGTCTACTGCGGCAAAACCGGTTTTGAATTCGAGCATTTGAACTCGGCGGAGGAGAAAA
AGTGGTTGGCCAATGCTGTTGAGACTCTGGCAGCTAAGGAGGTCTCTCCCTCGGACTTGCGCAATGCGTACTCTAGTATGCTACGCGCCGATGTTTTCGA
GAGCTTTATGGCTAAAAAGTTCGCGTCTTTTAAGAGATATTCAGGCGAGGGAGCAGAGTCCATGTTGCCAGCAGTCGAGACCGTGCTGCAAGCTTGTACA
ACGTCGGGCGTGTCCGACGTTGTGATCGGTATGCCGCACCGGGGGCGGTTGGCACTGTTGGTGGGCTCGCTGGAATACCCAGCACACAAGATCTTTCACA
AGGTTCGTGGCTACTCGGAGTTCCCCGACGACTTCCGCGGCATCGACGACGTGTCATCGCATATTGCCACGACGCTGGACAAGAAATACGCAGACAAGAA
GGTGCATGTGTCACTTGTGCACAACCCGTCGCACCTGGAGATCATCAACGCTGTGGCGGCCGGCAAAGTGCGTGCCAAGAATGATGGCGACGCTAGCACA
AACGCTATGGCGCTGCTGCTGCACGGTGACGCAGCCTTTGCTGGACAAGGTTGCGTTCCGGAGGCTTTGGCGCTTTCACAGCTTCCAGACTTTCAGACGG
GTGGATCGGTGCACATCGTGGTGAACAACCAGGTGGGCTACACGACCACGTACCCGGATGGCCGTGCAACGCGTTATGCTTCGGATATCGCGAAGAGTAT
CGAGGCCCCGATATTGCACGTCAACGGTGAGAGCATCGACGACGTGATTCGTGCTTGTCGTCTTGCAGTGGCGTACCGCAACCATTTCCACAAGGATATC
GTCATTGATCTGATCACGTTCCGCCGTCATGGACACAACGAGGTGGATGAGCCGCGCTTCACACAGCCGAAGATGTACGAGCACGTGGATCAAGCGGAGC
GATTCCCCATCAAGTTCGCTCACGAGCTAGAGGCTGTTGGTCTCGTCTTGCGCACTAGCCACGAAAAGACTGTTGAGCGCCTGAACGACCACCTTGAGAG
CGAACTCAAGAAGGTCACGGGAGAACCTGCGTACAAGCCAACGGAGATTGACGCGTTCAAGGGAAAATGGTCAATGATGGCGCAGCCTAAGCCTGAAGAC
CTGTACGTGAACGTGTCAACGGGAGTAGATATCGACAACCTCGTCCAGGTTGGTCTTGCTTCCGTTGAGCTGCCTGAGCGTATTCAACCGCACGGCCGCC
TGCAGCGCACGCACATCAAAGCGCGACAGAAAATGCTGCAGGTCAAGGACGGAGAAAGCCCAGCGGCTGCGCGTGTCGACTGGGCTACGGCTGAAGCAAT
GGCGTTTGGCACGTTGATGCAAGATGGTTACTCGGTGCGTCTTGCCGGACAAGACTGTCGTCGTGGCACGTTCAGTCAAAGACATGCTTCATTCACCGAT
CAGGAGACAGAAGAGAGATATTTCCCGTTGCAACACCACTTGCCGAACAAGTCAGATACGACTGGTAAGCTCAGCGTTGTGAACAGCAACCTGTCCGAGC
TGGCCGTCATGGGCTACGAGTACGGCTACTCGGTGGAGAGTCCAGAAAATCTGGTGATTTGGGAGGCGCAATTCGGTGACTTCTTCAATGGCGCACAGAT
TGTGATCGACCAGTTCTTGTCGAGCGCTGAGTCCAAATGGATGCGTCAGTCCGGTCTGATGCTGTTGCTGCCTCACGGCAATGACGGGGCTGGTCCTGAC
CACTCTAGTGGCCGCGTTGAGCGCTTCTTGCAGCTTGTAGACACTCCTGGACTAATCCCTCGATCCTCTGTGAAGGAATCGGATACCGAGGCTGTGTGGA
AGCAATACCAGCATGACACCAACATGATTGTGGTGAACGTGACGACACCGGCCAATTTCTTCCACCTACTTCGTCGTCAGCAGCAGCGTACGTTCCGCAA
GCCCGCGATCATTATGGGACCGAAGATGTTGCTTCGTCTTTCCGACGCGACATCGCCATTGTCCGAGATGGGGCCAGGCACCAGTTTCCAGCCTGTGCTT
TCGGACCCGAGTATCATCGACGCCTCGCAGGTCAAGAAGGTTTACTTCTGCTCGGGCAAGTTCTACTACGAGCTCGCGAAGGAGCGCCTTGCTCGCTGCA
AAAACCCAGAGAGCATTGCGCTAGTCCGTGTTGAAGAGCTGGCACCGTTCCCATTCGAACAGGTCGCTGACGAGCTGTCCAAATTCGAGAACGCCAAAAA
GTTTGTCTGGGTGCAGGAAGAACCGGTGAACCAGGGTGCCTGGACGTACGCCCAAGCGCACATTGAGAAGCTGCTGGGCAAGAAACAGCACCTCGAGTAC
ATTGGCCGTGAGACGCTTGCTGCTCCTGCCGTGGGTTTGTCGAAACGCTCACATGAGCAGCTGGAGGTGGTGCTTACTGAAGCGTTTGGTCCGCAAAAGT
AAAAGTACGAGAAGCTCGCCATCAGACCGCTTGGTCGCTACGCAGTGATAGTAGACGCTCAGTTGTTCGCCATGTAAGAAGAAAAACAAACACAATCGAT
ATGAATACCCAGTAGATAAAGATACTACTGAAGTACTACGTAGTACATTCATTTGAAAAGTGTGTTCACTGGATGGATGCAGCGATCCTCGTGTAGGATC
GTTCTTGCTTTCGAATGAACTACTGCTACGACTTGACGCGACTTCTTCTGCGTCTCGTTCGTTTGTCTGCTGATTTCTGTCTGAACCGCAGGGTGGTAGT
TCTGGTGATGAAGCTTCCGATGGCTTCAAACTCGATGGTTCTCGTTTGTGAGCGTTGTTGTTGGAAACAGCATTCCACGCGTGCTGAAGGACTTCGTGTT
CGATGGCGCTTATGTTGACTCGCTTGGTAAAGGCATTGACTCGCTTGACTGTGCGGGCTCATTTAGCGCAAAAGGTTGTACTGGATGAGCTCAGCACTGT
GCTCAGCGGCGTTCTCAGTCTCCCAAATAGGCTCGAGGTGCTTCTGGCGTTGGCGATCCACGTGCTGGAGCTGACGGATCATTTGCTGGCGCATGACGTA
GCCCTGCACAACCTCGTACCAAACGCAGGCCTGTTGCTCAGAAGTCGGCGAAACATTCAGCACGCGACCGCTGCTGAGCTTCAGGGCCAAACCGAACTCC
GCTCCAGACCAGTAGAACACGTCGATCACAACGTCCGTGCCCAGTACCCTGGAGTTCTCGCGCTGGTCCTTGCGGTAGGAAATGTAGCCGTCGCGGA