Description :
From Genome Similarity Track
Location :
Scaffold_821:40608- 44121
Sequence
3513 bases(100 bases per row)
TCAATTTCTTGGCTGACCAAGGCTCGATGTCCCTGGCAGCGAAGGCCACAGGAGCACGTCTACCAGGAATGAAAGCGGCATCCGGACCGAACGGAGCCAC
GGGGAGCATCCCTGGCAGTGACGAGTTAGGGGGAGCGGGGATCAAGACAGATCCAGGGGATCCGCCACCGTGAGGCGATCCCGGGGATCCGCCACCATGA
GGCGATCCTGGGGAACCGCCACCATGGGGCGATCCTGGAGATCCACCACCATGAGGCGACCCCCCTCCACCAGATCCGGGAGATCCGCCACCAGGCGCCC
CCCCTCCGCCAGATCCAAGGAGTCCGCCACCACGAGGCGACCCCCTCCCACCATCACTGCCCGATCCACCGTCACTGTCGACGCGGATCGCAGATCCCGC
AGTGTCGCCTCCGGATCCCGCTGTGCCAGCGACTTGTGGAGGCGGCGTCGAGAGGGATCTCCGCCGGGCTTCGGATCGGGACTGGGATAGAGCCCGCCGC
GTGTCTTCCTCCAAGGCATCCTCAGCGGCTCGAGCCTCCTCCGAATCCTCTGGACTCTCGTCGTCATCGTCGTCGTCGTCAGCGTCCTCATCGCTTAGAG
TGAAGGGATACGGGCCGACAGACGGCGTACGCTTTGACGACGATCGGTTAGGAGGCCCTGAGCCGTCGGACCAGTCAGATTCCTCATCCTCATCGTCCTC
CGAACTACCCAGTCCACACCCAGGGGGAATGACGCGTTTGGCTTTCCCCTTCCCGGGTCCAGTACGGGCCGGCGGAGGGTTGGTGGAAGCGGACTGAGGA
ACGATGGGCGTCGTTACCGAAGGACCAGCGGTGGATCCCGTCTTGGACGCCGATCCCGATTTTGATACTGCCGTAGATCCCGTTTTGGCCGTCGATCCGG
ACTTGGACACCGCTGATCCTGTTTTGGATGGGGCAACGGATCCAGCCTTGGACGCCGTAGACCCAGTCTTGGGTCCGGATCCAGATGTTGACGCAGCAGC
GGTGGATCCCGTCTTGGACGTCGATCCCGGTTTGGACACCGTCGATCCCGTTTTGGACGTAGCAACGGGTCCAGTCTTGGACGCCGAGGTAGACTTGGAT
CTAGCGGTGGATCCAGACTTGGATCAGGCACCTGACTTCCAGGGAGAAACGGAAGTCTTGGGCGCGGGTGTAGATCCTGCCTTGGACACAGAAGTGGATC
CCGCTTGCGGAGCAGATTTAGAAACCGGATTCGTTTTGGGCTTGGCTTTCGGGGAAGCTCGGGCCTGCTTATGGGGACGGGAGGATCCGGTGCTAGGAGC
GGGAGATGTACTACGCGGGCGTTTCGCAGTCGACGAATCCGCCCCACTTACCGTCGGAAGAGGAGCAGAAACGCTAGCAGCCTGAGAGGGCCCCGACAAG
GGAGGAAGTGGATCCGAGACGGCAGCTGTCACCAGCGCCAGTCGTCGACGTGCCAAATCGCGCTCCGACAGGCCACGATCGCGCTCCAGGATCAGCTGTT
GCTGCTGAGTTTGGGCTGCGGAAAGTTGATCCTGGAGTTTCGCGGTGGTCGCACCTGCTTTCTTCAATTTGTCACCTAGATTGACAATAACAAGTGAATA
TGGAGTTACTAGCAAGAGCTAAAAGAGGATCCACGTACTCATGCGGCGAAGCTTGGATTCCAGCTCCGTTAGCGCACGCTCGGCATCCGCCCACTCGGTA
GTCGCCTTGTCCCGCTGGAGCTCGCTGTCTGCTAGTTTTGTTTGGATCTCGTCCCGCAATCGAGTCATACGCACGAATTCTTCAAGCGCGTAATCTCGTC
CGGCAGACGCCCTCTCGAGCGACTCCTTGGTGTCTTGCAACTCCTCAGAGAGTTGAGCCAGGGCTACATCCGGCGACGAGGGAGGTGGATTTGGCGCGGG
GGACCCTCCACGCGCCGACCCTAAGGCGGATCCGTCATGGGCGGATCCCACATAGTCGTTGGTCACCACCTCCTCCTGGGTCAAACGCAACTCGTCACGG
AGGCGGTCCAAGCTCACATCCGCAGCTGCCCTAGCAGTCTGGGAATCCTCCAGGTCTCGCTCGAGGTCGTGGATCCGGGATTGGAGTTGGTGGATCTCAG
ATCCGGCGAGTGCCATCTCCCTAAGGAGATGGTCGTTGTCATCTCGCATAACGTCTCGTTGACGGGAGGCGCGATCCAGCCGTCCGGTCAGGTCGCGGAT
CTCGACCGCCTGATCAGCCAACAGGAGTCGCAGGTCCTGCGACCGAGAGGCCGCACGGTGCTCCCACCCCTGGATCTCCATCGCTTGGTCATGGATTTGG
GCCCGCAAGGTCTGAAGTTGGGTAGTGTGTAGAGACGCAGCTTGGTCTTGGGCATCTTGAGCCGTCTGGAGCTCCGCCGTCAGGGTTTGCACCTGATCGG
AAAGAGCCTGGGCTAGAACCCGCAGATCGGTGGGCGACATGGAAGACGGACTGACCGGAGGTGTAGTGGATGGGACCTTGCCCGACGATTTGCCGGTACG
CTTGGCGGGAGACATGTGTCGCGAAGGGGAGAAAGCGGTTGTGGATGCTGGTGATGCACGTCGTGGACGCTGTTGTGCAGCGCCGACCACGTACAGGAGG
CGATTGTGGTGAAGTGCTTTCTTAGAAATAAGAGAATGGTCCTGACGCGGGGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTATAGAGGATTTGG
GTTGTTTGGCACGGGTGCAAGTTGCCTGTGGTGGATTAGCCATGGCGAGCAGCACCCCGTATGGAATGACGATGGATCTGATATGAGCGATGTACGAGAA
GGCAAGATCCACCAAGACTTACCTCGGATCCACCCTTACCTGGATTCACTAAGATGGATATGGGATATACTATACAAGAGTGGATCGGGTGTGGATCCTA
TGAAGGAAGGATGGTCGGTGCGCTCTGACGGTGGAGTGAGTAGCCACGGCTAATGAAGAGTCAAGATCCACCGCGAGGTACCCCCCGAAACTCACAACTT
CTCTCTATTTTTTCTCAAAAAAAGAGAGGGAGAATCTCGGCCTGGGAGGGACTCGGATCCAGGTATATGGATGTAGGGAGACCTGAATTTCGAATTTCTG
GGACAAGGAGATCACGACGTTGCGAGATGATGTTGGATGATTGGAGAGCTCGGGTCCACGGCGAGTGTACAATTACAGTGAGGTGGATCCAAGCGACCTG
GATCCGGATGAGTGTACCCATAATAGGGTGACCATGATGATTACGTCATATATCCGGTGGATCTGAAGATAACACAGCTGGGATGATGGGTCAAGGGAAG
AAGGGACATGCAGCCGAGCCTGGTAAGGGATTTAGCAGATGAAAGACATAGAAGGTAGAAACCCAGGCAGGTATAGGCTTAAATATCAATACAGACCTCA
ATTTGCACTGTGGAGGGCAAGTGACCTGTAGTCGTCTCGGGGGTTGGATTTGGCCTCGGGCGATCGCCGTAACAGGAGTGAACATTGGCCCTGGACAAGG
ACAGCGTCTACTT