Description :
From Genome Similarity Track
Location :
Scaffold_43:40600- 45199
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_43-snap-gene-0.61CGMP-dependent protein kinase (ISS)
Pytap_DAOMBR444snap_masked-pag1_scaffold_43-abinit-gene-0.102Gene of unknown function
Pytap_DAOMBR444snap_masked-pag1_scaffold_43-abinit-gene-0.87Conserved gene of unknown function

Sequence
4599 bases(100 bases per row)
CTTCACCGCCTCCTTCCGAGCTTTCCATGTGCTGAAGGGCTTCGTCTCGCCACTGGAACTGGTAACGAGTGTCACGGTCTCGAGAGCTTGCTCCAAGTCC
ACGCTCTTGGCGTCGAACCGCTCGATCTCAGCcAGTGGCACCCACTCAAAGAGGGGAATGACGTAGAGGGTCATTGTTGCTAAAGaCAGCGTCGCCATTT
GCCGAGCAAAGCGCACAGCACTCTGCGGGGTCGGAAAACACTGGTACACGTATACCGCAACGCTTtCCAGGACTTGTGGCGGCCATTCGATGCTAATGCT
GACACAAGCAAATCGCTGACCGTTGCCCAAGGGTAAGTCCAGGGCTCGATACTGGTATGCACTGGCGGTTCGATTGGGTGAATTGAAGTAATTTTCCATC
GTCATTGTGATCTCGTCTTCTTTGTATATAGCAAATCGACTGATGTCTCGGTTTCCGTCGACAGGTGGTACAATCTCCAACGAgCAGATGTGTCGAAAaA
GATCCAGAGCTTCACTGAGTTCTGTAAACTTGCCAAACACACGGAAGGCTGTAACGAGAGTCATACTGGATGTTCGTCCTGGAGATGCTGGTGCTCTGCT
GTTCGCAGATCGCGCTGACGCGGCCAAATCCTTGGTGTTCTCTCTCATGAAACCCACGACAGCAAAAGGTTGGCATACGCCATGAACTGGATTCCAGATA
GTCGACACATTAGGCACCGATGCATTGACTGGCTTTtGGTTCAGCGATGTTTCCGACCGTAGGCGAATGCTGCGACGTCGGTCTGACGAGTTGTTGTTTG
TGGATCCGGAtGAAGCCCCATTCTGTGGTGATGATGAAGtGTACAAAGGCTTCTCTGTGAAGAGGGCTGGTAACATGGCGGTGGAATTCTCTGGCTGGGT
GTCAAGGATTGCCATCGTTTTACtCTTCACCATGGATTGGCGTCGGCCTCGTGCGATCACTTTGGCTGGAAtAACCTCACCTCGATTCGTCTCTTCATCA
GCAGTGCGATTACCTGGGAGGAGTTGAACGCTCGGCCTCCTAACGCGATATGACTGCtCTTTTTGATCTCCACTACCTGAGTCTCGACGTGACGCATCCG
TATCAGATTGTGAATCTTCACTAGCCTTTTtAGGGTTTCCcACTTTCTGGTCAAAGGCTTGTGTTGAGCTTTTGCCTGGTGACGCTggtgAGTGTTTAGG
ACAATGAGCTTCGCGTTtACTCCCTTTGTTCTTCGTTTTGATTTTCTTCTGGTTTGCACCGCGTGGTTCTAGAACAATCGTTCCGGGTTCCAGAAGGGTT
TtGTAAGATCGTTCCATCGTTCCGAGGACAGGGACAGAGCTGGACTTGGATAGTGTTTTTGTTGGGCCGCGGCCAGCTCCAATCGTAAAACGTCCTTGAT
CACGATCGGCGAGAATATTCGCCAAGAACGCTTTTCGGTATCGCTCCCAACtcACAGTTTTCAAGGCTCGGCTTTCAaTGCTTTCTTGGGTCGATCCGAC
GGATGAGCGCTGTAGGCTCTCACGTGCAGGTGGtggCATGAGATGAAAGATATCGAAtCTGGATAAGACGAGGACACGGACTGGTGACtCTGCAATGATC
GAGTAGTCTCGAATGTAGATATCATTGAAAcGCCCTGCCGACGCTCTGGCACACAATCGTCAATCATATGCtATTTTACGAGCCAATCATGTGATCACAC
TTACTCAGCACATCCAAGGACTGAATTTGGTCCAAATCGACCAAGCTCATACTGTTGGGGTTGTCCAGTTATCGGATGTTTACCTTCGTGAACCATGACG
CACTCACCGCGTGTTACTACGAACATCTCTGTTGCACGAGATCCTTGCTTGCAAATctCGCcACGGAaGGGAAAATACTTCTCCGCCATAACTGCGCACA
TGGCTTGGATAgTaTAATCGTCCCATTCGGGTCCGATAAAATACGGGTTCTTGCTAAGCATCTTGGCATATTGCGCGTGATATTCGTTCTGGTATTTCTT
GATCAGAGGCTCATATTGGTCGCGACCCAACACAAGAAGCTCGCAAAAATCGGCACATGTTACAGTTGCTCGTCGAAATCCACCAGACTCGGAAAGGGCA
AGCTCTCCAAAGTACTCGCCTTCGCTTAATCGCGACACAACaTTCTCTGACGTCTCGTCAAATCGATTCTTCGTGCGAACAGAAACTTCCACATTTCCCG
aaaagATAaTaTAAAAATGCCGTCCTTCTTGACCCTCTTCAAACAATACAGTGTtGGTGACAGCGCTGATCAGCTTCATGGCTTTGCACAATTGCTTTCG
AACTTCGAAAGAGAAACGCGCGAAAAATTTCACACTTTtCAAATaCTCAACAGCAAaTTTGAGGTCTTTCTCTGAGCGCTGAGCTGATGATCTCATGAAG
ATATtGCGAATAATaTCTTTGTTCGAACGAAAGCGTTTCGTGATTTCTAAGGTTCcAGTAGCATCGGCTTCATGCGCCTCCTTAAGAAGGTCTGTAAAAA
CCGTtCGATTGATAAaCACAAGCTCGGCCTTTTCGCTGGCGATGATtGCGGAAGCTAGAATGgAACATAAGTACTCCCTTCGATAACTACGCGTGAaTAT
CGATATGCGTACCTGCGCGACGATCACTCTCATACAGCAaTGCTCGCTCTCCAAAaCTATCACCTGGGTGAAGATATGCGATGTGAACGGTTGGTGTTTT
CCGTATTGATGTCTCCACATTTGCCTGCGGATCTCGTTGCCGAATCTCCACTTCACCTAGCGTTAGTAGGACGAGCTTACTAACTCTGCACAGTGCGTAC
CTAAACCACGGAACACCATaTAAAAGCTGTCACCTGGGTCATCCTGTGTCATAGCTCGAGCTCTCGTCAATAATTGAACAGCGTATATCTAAAGGAGTAG
TATAGCACCTGTTCGAACACATAGGTTCCTTTCTCTTCATACAGTCCCAGTTCGATTGACTGGTACAGCTTGTCGATCTACTTGCAGTGTCAATTGCAGC
TAACCGACGCAAACCTCTCTATGGAGCCTACCTTATCTTCAAACAAgCAATGCGTCAACAAGTATCTCCATGGATCCCACCACCAACTATCTCCAGCTCA
CATGCGTCGAGATTGGAAAAGAACTCGAgCAGCTTCGACGTCCCCAACAGCGACTTGAGCTGCATGCATCATCATCAGTTTCTCACATTTACTTTTCACA
GTCTCTTTCTATGCCAGCACACCACATGGATGTCGTCTAGCGACCTGCGGCCCGGTCTCTTGAGTAGGATGGCGCGACACACGTCCACTTCGGGCCTGTT
CTCCTCGATCGCCTTGAGGAACGCCCCTGTgTGCGTCATTGTCTCGAGCTGCGATGCCAGTGACAGCTTCCTTCTCGGCGCCGAGGCTTCATCTTCaCCG
TCCATCGTCATTTTCTCCaTGCGCTtCCCTTCTAACAATGCgTGGGgAAaGGGgAGGGGGGGGGGggCAGAAATAGCAACTTCAACTTCCGAGCTTATGA
TGCACCAACGTTGTCGGTGCGAACTTAACACACGTACTTAACTGCCCGTTGCacTTGTCGTTGGGAGCACCTTCACTCTtCATCATGGGCACGACGGCGT
CGACGCCGACCCCTCCGCCGTCACGCGCATGGCTCGATGCGGATGCGTGGCGGGCGCGAGGTGAACAGGCAGTGCACAAGATGAAGACGCAGCTCACGAG
TGCGCGTTCGGTCGCTCTGTATGAGACCATGACGCGtCACGCCGTGGATGCGTCGACTGGAGGCGTGCTCTTCTGGCTCGGTATCTCGGCTGCACAGCTC
GTGCAACGCGCGGCTCGCATCAGTGCGTCCACACCGATCGCCCCTCGAGTAATAGGTACGCTTGCAGTAGGCtCGTCGTCCGTGGTGGCgTTGCATTTCG
CGTCGTTCCCTCGAGAGGCGATTGATGTCGGCGCGTGGAGCTTTCACTCCCAGAAGGAGAaGgCTGTGGACTGGACGCGCGTCACTCGCGATGTCATGCA
GCAGCTGCAAACGCGTACACAGGACATCGCCAACGCACCGTTCACGGTgTACATGGCCATGGGCATTCTGAGCTTCAAGATCTTAGGCGGCCGCATGAGC
TCGCTGGCGCCCAGTCACTACaCGAACCTCGGCGCTTTCCACCTTCGTAAGGCGTCGCTTCCAGCAACAGAGCTGTACGCTGGGACCACAGAACGTGGGA
TCCTTCAGGAGTTTGGTCGCCTCTTCGGCTGCCACACGTGTGGAGTAAAGAACGCTGCCAAGTATCATGGCGATCACATGCCCCCGAAACTGTGCGAAGC
AATGTTATCTTTAtgCGTTCTGGGTGATGaGggAAGACTAACTCGTAGATACCCTACCTGCAGTGTGGCTACGAGAATGAACCAATCTTTATGGAGGATA
ATCACAGGTAGAGAAGTCGGTTTTCGGTtCTATCCGCAGTGCTCTGGGTGCTCAAATCAACAAGGCGCGATCGTCAAAGCTGGAAAAGACGGCTTCAAGA
CTCATTTCGGCTCTTTGCGTCTGTATCACACGACAGGCTTTTGGCTTGTATTATTGTGCACAGGAGGGCTTTACTTCGGTGGCTCGACTTTCCATGGTA