Description :
From Genome Similarity Track
Location :
Scaffold_1836:406- 2425
Sequence
2019 bases(100 bases per row)
CCATTGTCGACAATTTCCTCCCGACAGCTCAAGCTCCGCACAAGAAGGATGCCAGTGCCCACTCTGGGGGTGAGATCACCTTGAGCTTCTCATCCAGCCG
TGCCTGGAACTCGTCGTCAGTCAAGCGCTCATCGATGGGCGTGAGGAACTCGTAGTTCGAGAACATGGGTCCGCTGTACATGACGTTGTCGACCACGAAG
AAGCCAAAGTGCACGTCGCCCACGCCGAGGTGCAGCACGCCGCCAGGGTCGTTGTGCTCGATCGACGTCGTGTCCGTGTGCACGTCGACCACGACCACAT
CGCGCTTGCCCGACTCCTCGCGCGACTCGTAAAAGAGCTTCGGGTACCAGCCGGCGTACTTGGTCCCACCGCTGCCGTGTCGCTCCTCCATGACGGTTTT
GATGAAGTCCGTCTGCTCGTCACTCAGCGGTTGTTTGTTAAACTGACACACCGCGATCGCCTCCAACGTCACCATTGTCTCGGCAAACTCTTCAAAGAGG
TACTCGCCGCGGTCTCGCAGCGTCGAGTCCTCCTCGGGCGTCCGCAGATTGCGAATGATCCTCACCATCCGCGTTGCGAGTTTCTGCATCATGCCGTAGA
ATTGAGGGTACGGGTCCACATATCCGGCAGCGTACTCGCAGCGCGTCTGCATCGTGTAGCTCTGCTTGGCGTAGAGCACTGTGTCGTGGCGCAGCTGCGT
GAACGATGCGATCTGCGCGTTCAGCTGGCGGAGCTGCCACACGTCCGAGTGGAACACGGTCGCCTCATTCATACTAGGCTTGGACAATTCACGAAGCGCA
CGCAGCCAGAGCGTGCTGATGCTTTCTTTAACTTCAATGTTTGCTCCTCCGCTGCTGGTAAACTCGCTGTCGATCGTTTCGCGCAGCGCGATGAGGTTCG
ACGCGTACGGGATCCCGTCACGAAGTGAGACGAAGTTCCCATTCTTGTCATCGCTGCTGCTACTGTTCATGCGCTGGGCTGCGATGGCGCCGGCAGAGTC
GTTGCCAAAGAGCGAGAACGCGACGTCGATCGCACTCGGGATGCGACGCACCACCTTGCTATCTTCGTGGACGATCTGGTCGTACACAAGCCTCGAAAAG
ATGAACGAGCTCCAGACGAACTTTTGGCCAAAGAACGCGAACGATGTCGGCAGCACAGTCGGCACTCCAGGCGAAGTGTTCTCGACGTGTGGGTGGCCGC
TGATGAGCTGCGCCCCGAGTCCCTTGGCTACGATCACCTGCTGAAAGGTGAGCAGCGCCTGCGGGGGGACCTCATTGTGGCCGACGTAGGTCTCAATCAG
GTTCAGCGCGTTGTCTCCTGGTAGCAATGGCAGCAGTTTGTCCAGCTGCATTGGCGTGAGTGAGTCAGTGCCGACACCCGCGTCGCCTACCAAGCTCGAG
ATGAGCTCGTCGAGCGCGTGCAGTCGGGACATGCGCTTCGTGTCGCGCAAGAGCCCCACGAGCACAACCGCGCACTGCAACTGGTACAGATCATTCTCTG
GATGGTCCGAGTCCCCTGCGATGCGAAAGTCGATCGTGCCGAGCCACGTCATGGCCTGGAAGTACTTGCTGAGCTCCTTGGTCTTCACGTAGTGTCCCCG
TGGCTTGAAGAGCGAGAAGTCGACCTCGCGCTCGCTGTTAAACAGGTTTACGCACGCAGTTTCCTGGGTTTCAATGCTCTTGTAGAGCGCCGATACGCGC
GCGTCGTTCGCTGGGAGACTGAACGATTCCTCGCCACGCAGGAGACTCACAGCCACGGCCAGGAAGAGGTCGACGTCCAATAGAACCTGCGTGGCTCGAT
TGTCAATAGCAGTCACTCGCGCGGGGGAACTGAAGAGCTCGTGGCACTTTGCGCTCGTCTGTTGCAGGATCTTCTCGAGCACGGGGATGCACTCGTGGGT
CTCAATGTCCACGAGTACGGCGTCGAAGCTACGGTGCCACGCGTGCAGGATCGAGTCCGTCGTCACGTACACGGGCATGTCGTCCGAGTAGAGACGGTAG
TACACCTCCGCGAAGCTCT