Description :
From Genome Similarity Track
Location :
Scaffold_531:406- 2352
Sequence
1946 bases(100 bases per row)
GAGAAAGGTCGGGCCAGAAGTTGAATCAGTAAGGTTAGGTCGGCGTTTCTGCATTATCAGGACGGAAGAAGAACAGTGTTTGGTATTCGGGAATCGAATG
ACAGAATCGGTAAGAAATTGGTACATCCAGCTGATTCGGTCAACTTGTCATAAGTGGAAGTCCTTGCCTGAATTTTTTCTACAACAGAACGGATGCTGTA
TAACGTCAGCGGCGAAAATGTTTTGCCACTTGCGGAAGCGATCAAATAAAACCCTTTGAGTATTAGTATCAACTTAACGTCGCGGCTACCTGAGCAAAGT
TCGATATTAGAGCCACGCGCAGCAAAAATGTGAAATATTTTACAGCGACACTAGACGATCAAAATTTGGCCGATAAATCCAATGCGACTGATGAAGACAA
ACGTGACGGGAAAACCAACCCATATATCAGCGGATGGTAATTAGACATATCATATCGTCGATGATGGGCAAGGTTTTCCAACTCGGGATCGCCTGTCCAA
TTCCGGTGACCTCAAAAGGGTCCCGGGCAGTCCAATTGACTCGTGGAAAAATAAGAGCAGAGGATTGGATTCGAAGTCTAGTGGGTCGGGTATGGAGGCG
GATTGCCGTTGGGTTTGTGTGATGACTGCATTCGACTATGCAAATTCGTAAAAGTATCATTGTTTTTGTCAAAGTGATGTAAATATATGAGATGGAGACT
ATCATTGTAAACGATCTACAGCTTGTACCTATTGCAGCTTGACCAGAAATGCTTTTTGAGGGTGCTGGAAGATGTTACCTGCCAGAAACATGGTCGGAAG
AGGAAAAAATCGGATAGTTACTTCTACATGTGTGCAGATTGCGGGGAGATGAACGAGAAGGCACACGACCAGCGGAAGTATTAAACAATTTCATATACAA
GTGGTACGTGCAGATCATACGACAGAATGTTTCCGCCTAAGGTGGTGTGTGTGTTAAGCTAGGATACTCTTGAGATCGGAGTCTGGCACAAAACGAGCGT
CATAGGCTTTATATTTATGCAAATCTCGAAAGGTATCGGAGATATCAATATATAAAGACTGTTCTAATACGATCGCTAATATATGTGACAATTCTACAGT
TTTCTTCAGAATTAAGTGCAAGACGAGTAAATGACTACGCATTTTCACCTGTGAGGTTGGAGCTCAATTTTGCACCGAAAGAATCGCGCGGATATTGAAA
AAAACACAATTCTGGATATATTAAGCAAGTAAAAGCAGTAGACAAAACCAGCCTTGGAAAAGCCACTATGCTGTTCGACTCTGGCGNNNNNNNNNNNNNN
TCAATAATTGATGCCACTATTGCGAGTAAGGTAGGATATGTCATCGATGAAAGTTAAACGCAAGAGCGCTTCTGTATAGGAAAGAATGCGTACATGGCTT
TGGGGCGTACAAAGATTAAGACTAAATTGGAATGTTCGATGGTGCATTAGTTTGACGTATAGATCGGTGATAAATTCGGTCAAGAAGTCACATCGGATAT
GTATTTCATCTTTCGGGCGGGCATACGTTTGAATTTATACGGCGGAACCTAGTGCCTATCAGACGAAGTATGGGTTGGTATTGAAGAACAAAAATCGCCT
GATCTATCGATCTAACAGGTCATCAACCTAAAATATCAGTATGTGGTTATTACGGTGGGTAGATGGACTGAAGTGGGCATCGGTGCTGGCCTATTTAATG
ATAAACTCTGGTGGGTCGAGATGTGGCATAGATGTCGACAGTAATTTGTGGTCCCAGCAAAACAATTATTGACATCTTACTAACCTCAGTGATCGTGATG
TAATTCATAAGTTACGGAGCCCCGTTCGGTCTGTGGATGGCATCTGAAATGGTACCGCGATTAAAGGGCTATGTATCAATTGGATCCATAGGTATATCGA
GTGGTAAGCGTTAGACTTTGAAGCCACCACGAAACGAGAGGAAGAA