Description :
From Genome Similarity Track
Location :
Scaffold_1081:406- 1598
Transcript NameFunction/comments
Phypl_g12302conserved hypothetical protein

Sequence
1192 bases(100 bases per row)
ACCTTGAAGAGTGCTGCGACGCTCGTCACAAGAGCCCGCACGTTGTCTGGCTCGGTGTCGCTGTACAGCGTTTTAACGCCGATCAGGAGCTTAtcaacgg
cggcagcacgctCCCGCGCAAACTGTTGCTGGAGGGCTACAAGATCCCGTTGAATCTGCCCGCCGTTCACGTTGCGAGCCTCCTTCGGGAACAACCTAGG
CGCGTACTTGATGAGGAACTTGATGTCGGACAGCTCGGGCAGGTGGTCGTAGATCTGGTGCACCATACCCTCGACCCTTGTGGGGTCGATCCGATCAAAG
TACAAGTTGCGGATCTTGAGTTCAAGGTCAGCAGCGCGCTTTTTGCGCTCGGTAGCGGTTTTCAGGACGTCAAACTCTCGGCGTAGGCGTgtggcgtcca
gcgtctcgaagctTTCGATCGAGAACTCCTGTGGAAAAAGTCGCTCGGCATTTCGGAGCAACGAGCGAACGTCGGTGGCCTGTGGGAACAGCTTGAgcac
gcggtgcagcacGGTGTGGAGCACTGCACTGGCCGCAGCACTGTCGTCGTGGCGTTCGAGGCGGTATGTTTTGTCTCGAAGCAGGTCGAGCAACTCGTGC
TTGAgttgctcgcgctcgtccttACGCCGCAGTTTGCGAAGTATTTGCTGACACGGCGTTGGCACTGTCTTGGTGGGGCTACCGATCGTGGTAGTAGTTG
CTGTCTGGGCGTTGTTGTCGTAGCCGtcgagcgagaagatgagggggtcgtcgtcctcgtttCTCTTCAAGATGTGGCCCTTAGCTTCCcagcggcgctg
cagcggtGTCTCGTCGATGTTGATCACGCGAAGATGTTGCAGACGGCCAAGTTCTTGTGGGAGCGTGTCAAGTGCTgaggagctggcgtcgagcacttgc
agcttGGTGCAATGGACGAGTGAGCTTGGTAGCCGCTTCAGACTCGGATTGTTGTTCACGTACAGCTCACGCAGTGCAACCAGTGATCCGATCGTGTCAG
GTATGGCTTGTGGTCCGTCTAGCTGGTTGAAACTTAGATCAAGTCGTACCAGTGTGGCAGCTAGCTCTCCAGgtgaggatgaagaggatgagGAAGGCCC
AGATGAAGCATTTGAGAAGAGTTCGGGTGGCACTCGTGTGAGCTGGTACTGAATGAGGTGGAGCATGCcacgcttcttggcctcgtccacct