Description :
From Genome Similarity Track
Location :
Scaffold_1:4058825- 4062173
Transcript NameFunction/comments
Physo_476054Hypothetical protein
Physo_436986transmembrane protein, putative

Sequence
3348 bases(100 bases per row)
TTGCTAGACTACTTCTACTACCTCCGGGTGCTGGGATTGAATCCATGCGATCCGCCAGCGCATTTGGGATGTAGACACTTGGTGCGATGCAGCACAGACC
GATCTGAGCAGCGTCCTTGGACCACAATAGCCTTTATGCTCAGCGGAAAACTGGTCTCCGCCCACAACAAGGGGCGGAAACCTAAATTACCTCTTCACCG
ATCAAGGATTACGAGCCGATCTACGCAGGATGCACAACTCGACCGCAGATTTTCTTTGAGGACATGACAGCGTCTCCGGAAAGGTTTTCCTCCACGTCCC
AGTACGGCCTGGCCGACTGGGTGCAAGGTTCCTTCATCGGATTGGCTGTCCTGTGCGGAGTCACGTCCAACGTTTGTGGATATGGGCTTGTCCCCCAGCT
TACGACTCCACCTCTCGCTCCAGTCACGACTGTCAAGATCCGCGGGTACCGCCGCTCCAACTGGTGCACGCGCTTCACTATCTCCTACACTTTCATGGGG
CCTCAGCGCGCACACGCTATCATGCATCGCGATGTTGCCAGACCGGTTCATTCGCAGGAAGTCGCCACCTACTTCCTACTCTTGGGGCGCCTCAACAAGT
CTACGACTTGCCAGGCAACTTGCTCCTAACCTGCGAATGAACTGCTTTGCCCCCCCCCCCCCCCCCATGAAGATCGTTTTGGAAGATGACAATGTGGCAA
GCTCCTTACCGGAAAATGGATATGAGCTGAGGAGCTTCACTTTCTCGGCATGGCTACTTACAGATGCCTTGCGAGTGGAAACTTCATTCTCACCTATAGG
GACGTCCAACAACACGACGAGTCGCTAATCGCTCTATTATTTAAGAAACTTAAACAAAACTCAAACCCAAGTTGCTGTTTTATACTTTTTTAAGTATAAA
ATACCCTGCGAACTATCCCTCGAACGCAAAGAAGCGAGCGAAACAGGTACTTGTAGTAAACTCGAAGTTCATCAGAAAAGTAGGATTTTGAGGGGTTACA
AAGCTTTGTCCATCATTTTACTAATACTGTTGAATCGGACAATCGAGCGACAATGGGTGCACAGATAGCTCCAGACGCGAACGTCTAACCTGTTGACGCT
CAGCTGACTTCCGCTTGACGGTAACGAGTGCTGTCTGAGAACCTCTGAACACGGATTGGTAACTATATAGTGTATATTACTGGCCATGATACGCCGTGGG
CTATGTCTCGTACGGGTAGAGTGCGCCCAACAAGTCAATCGGGAACGAGAGATCTTGTCCTGCGAGCTGGGAGCACATGACTTGGTACGTGAGTGTCGGA
TCGACCATCGGTGTGGCGCAGAAAGGAGTGCCGGAGGCCCAGACGACTTTCGTGTTGGTCTTCACCCACGCTGGCATGCTTGTAAGCGACGTGTTCTGCA
CATTCATCGACACTATGAACGCCGTAGGCTCCATTAGCGTTGCTGGCAATTCCTTGAGAGGGTTGGCGGCTAGCTGCAGGTTCGGTAGGACGATCCCAGG
AGGCATCATGGCCAACGTCGGGATGGTTTCAATCTGATACTCTAATAGCGACAGCGTGTACACGAGCGAGAAGAACATTTGGTACGGGATCTTGGTCAAC
TCGCTGTGCTCGAAGGCTATCGCAGCTAGTGGGTGCCACCGCTGGTACAGATCATCGGGCAACGTCTTGAGGTTCGTGTGTGAGAATTGCAAGCCCATGA
CCGATCCCGGCAAGGGCTGCAAAATACCTTCTGGCATTTGGTCCATTCGCGCCCCCGCCACAAGCACCACCTGTAAACGCCTGTGAACAGTGGCGGAGAT
GGAGCTCGTGACATTCCAATTCACGATAGTCGTGTTGCAAATATGCAGCGACACCAAATTCTCGAGACGCTGGAGATCCGGAGGCATCTCGAGCCCATGA
CAGTGAGCGATTGTAAGCGAGGCTAGAACCACGGGGTCCAGCTTGTCGAAAGACGTCTGATCTGGCGTTGTAGTGTTATGAGCGTGGCAATCGTACACCA
AACTCGCACACGGCTCCTTGCCGCTGGAGATCCAGGGTCTCGTCACTGCGCGACAGCCGAGCACCTCGTAGTTCGCTGCACGTTGGGCCGCTAGAGAGTG
CAGCAGGAGGACGATGAACCCCCACAGGACGAATACGGTGACTGTAGCCCCATGTTTCCACCTCTGGAGGGTGTGTAAGCTTTTAGATTGGCTTGGAGTC
TGAGAGCTTTCTGCTGACGGCTGTAGGCCAGCAGCCTTGATAAAGCTTGCTCGTGATTTCACCTCCATAGACTGCATGCTCGGCCGTCCGTCACCTGGAA
TCACCTTGACGTCTGCGCGCCCCAGCAGCTCGCTCATAGTGATCAACGAAAGCAATATACTGAGCTGCGGGATGAGCTTCGTGGTGAAGTCGAACAAATT
TGCTGCAAAGACCACTCGATTCTCCAAAACCATCGAGACCACTGAAATGGGGTCGTACATGAAGTTGGGGTTGTTCAAGGATTTGTACTCGACGTTGAAC
GCTTCAACGTACGGGAGGAAGATGATCAGCGGCACGACAGTCACCATGCCGAAACTGATGATCGCGTCGTACATTAAGGTGAACACTCGCCCCAAAGCGG
GCGACTTTCGCAGAAAAAACTTGAATGCCCGCTGTCGTCCGGCAGTTTGCAATCAGCAGCGCAACCATGACCGTGTTGAGCTCCGATCGGGGCAGGAGGT
TGCTGGCTCGATACGATTGGTAAGTCTGCGCGGCCGCTGCGATGAGCTCTTGGAGTGCAAACACCGTGGAGAAGTGCTCGCTCTCGACGCCAAAAATGCC
TCGACGGGAGAGGACCCTGATCCACATCCGGCAAACCTTACGCCATGCTCGCGACGCTACTCGTAGCCGTGCTTTCGGCTGGCCAGAGCTCCTCGCCGCG
TACTTGCCCAAGCGACTCGACAGCACTCGATCGACCACGCTCCACTCTGACCGAAGAGCGGTTGGCGGGCTCGGATGGACACCATAATGATCTTTAGCAC
CTGGATTCCGTGCATCGCCCCCACAATTCCGAAGGCGACGCTGTAGAAGCGGTAGTTGTCGGCACCGTTGAGTGACCAGATCGAGACGTAGGTCGGCATG
ATCGTCGTGGTGAGGAACCAGTAGGTTATGGCCACGCAGACGAGGAACGCGGCAAACTGCGTGGAAGAGCACGATGAAGAACCACGCCGCGGCGTACAGC
CCAGGCGAAAGATTCAGCGTGAGGTAGGCGCCCTTGTGCTCAAGAACTGTTGTGGAACTCATGCGCACCTCACGAAAAATAACAGTCTTGACTGCTTACA
GTACTTGGGTAATGGTGTTAGATCTCAACGGCAGGTTCCCGATTGAAG