Description :
From Genome Similarity Track
Location :
Scaffold_703:4058- 6714
Sequence
2656 bases(100 bases per row)
ACCATTCTATTGGGTTCCGTCAGACAGCCGTATAAGAGGGGTTGAAATACCGCTCCAACTCGCTATCGTTTCCAGCATGTTAAACCTTACGCACCTGAAA
GTTGTTCGAGGCACTTGATGGCCCTACTTTTCAATTATGACGGGCAGATTGTGATCATCGTCAATGTATATGCTCCGATACACAAGCCTGACCTTGACAA
ATTCTTGTTGGACTTGCGGTTCATTTCGATAGCCAGCGATCACCATTTATATGTGGATGGTGACTTCAGCTGTACGTTGCATAATGCGCATGATCGAGCA
TGCTGAGGATCTACCTTGAATCATAACTAACCGGCACTACATATGTTGTTGCACTACTGGTTGCTGATAGAACCTACTTTGAATGCTGTGACACCACTGG
GAGACGACATTGACGGAGTACCATACCACATATCACACGTACGACTACAAAGATCCGGGCCACGGTCAATCCTCCAGTAGGCTCGATCGGTAGTTTGTCA
ATGACGTGGCACGAATGTGTGCTGCTTCCATGGAAATCGACAGATATGGGCACGCTGGAGACCTCAAAAGAGTCTTACTGCATCTCAGGAACCTCACCAA
CGCGGAATTCGTCAAACGTAAACCGAGGGCATCCTGTCCAACCATACGCTCAGGCCCATAACAAACAGTTTTGTCGGGGCAGCAACTTGAGCATTTCACG
GACACGCTCACCTTCACTGATTTTTTTGCGCACAAGACAGTACATGTTGGCACATTTAATGGAATCATTGTTCTATAAAAAGTAAAGGCTACACAGAGCC
TGAAAAACACTTACAGGAAAAGGGGCTGAACAGAGGGTATGGCAGGTGCAAGGTGGCATTAACGACGGAGTCTGTGACAGCTCACCCAGATCACGTGCTA
GATGGATTACAAGACAGGCCTCATTAACTCCAAGACGCCACTACCGAGACAAGACGCATCTGGTTAGATATTACCGGCGATACCGTCAAAGTACACGGAG
GAAAGGATAAACAACCACAGAGTTCTTTAAACGGATCTCGTGTAAGTTTGGGGACAACGTTGTTTCTACCCCACGTCTTACACAAAGGAACGACACTTAG
TTCGCACTGCCAATGAAAAAGCAAACAAATTAGTGGACGCCTGGAGCTCCGTACTATACGTATTTTACGCTTTATCACCAGCGTACACTGTAGCTAACTT
GATGGATCCTGGCCTTACGGAAAATTTAGAATGTATTGGGACCACACTATTTGTCCACGCTATAAACAGTCAGATCGAATTTTGAGATATTGAAGAAGGA
GGGAAACGATAATGGGAAGGATCGCCTCGGTATCGATTGGTACCTCTAATATGTGGACATACTAATTCTTCTATTACCCTAGCTTTTTCGTGATGTAGTA
CGGAGACAAAGCTTTTCCAGCACCCAACCTCAACATATACGTATTATGTCTCAAGAAGACGGGATAGCATTCCTTTGAACCACCTCCCTCTTCCTCTACT
CAACTTAGATTACAAGCTATTCAATAAATATTGCAAGCCAGCTTCGGGGTAATCCCCCAGTACGGATTTATTCGCATCATCACGGATTTGTGCCTAACTG
GCCAATCCATACATTATTAGACAACTTCTTCTCAGCACAGAAAATGGCCACGCATACGCATGAACGTATGAATGCGGTTGCTACTTGATTGAAATCTGCT
AAGACGCACGACGCGCTGGATTGGGACCATCTCTTCGCAGTTCTTCGTAAAGACCGGTAATCTCACCACCTAGTGAGCGTCATTGAGAAGATACATACGG
GGACTTCCAAACGCTTTATAGCAAATGGGGCGGTCGCGACAAGTACCTATTACCCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGC
TGGAAAAGCTTTGTCTCCGTACTACATCACGAAAAAGCTAGGGTAATAGAAGAATTAGTATGTCCACATATTAGAGGTACCAATNNNNNNNNNNATCCCC
GAGCCGCACCAAACCGCGTGACGATGTACAGAACTAGATCTATCTCACCCGTATGCTTAACATAGTTGGCCGNNNNNNNNNNCACCTGGAAGCACTTTGT
AGTCCTTCCAGCGACCACAACCACCTCATCTGACATGAACATGTTGGATGAGGAGGAGAGTCTTCACGCCACGCGTGAAGACTATACCCATTTGAGTGAC
ATCGAATGGAGTGNNNNNNNNNNCGAAACCCAAGCAGGGTAAGCGTAATGTGCACACTTACACTGAACACATACGACTCCTCGCGAGTAGTATANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGCG
TATGTGTCGTCCCGCCCACAGCAGCATTGAATTGCTGCTGTCTCAACAGCTCTGTC