Description :
From Genome Similarity Track
Location :
Scaffold_425:4058- 6486
Sequence
2428 bases(100 bases per row)
CCAGCTAAGTTACCAGCTGACCGAGGAATTCGCCACGAGATCGATCTCATGCCCGGCTCGAAGTATTGTGTGACGCGGCAGTGGCCGCTCCCGCGAGATC
AGGTCCAAGCTATCGACGACTTCTTCGAGAGCCGCCGCAAGGCGGGTCATGTGCGTGAGAGCACATTGCCGCACTCCAGCCCGACCTTCTGTGTGAAGAA
ACCCACGGGTGGGTGGTGCATCGTCCATGCCTTCAACAAGCTGAACGACGCTTCCATCTCTGCCCAGACGCCGATTCCTCGGAAGGACATGGCTCGACGC
AATGTCGGGTAGTGAGGTCTTCAGCGCCATCGACTTGACCGATGGGCTCTACCAAATTCTCATGAGGCTGAGCGACATACCGCTCACAGCGGTAAGCACT
TCCAGTGGTACATTTGGGAGTGGCTTGTTATGCCACAAGGCTTGAAGAATGCTCCCGCCATGTTCAATCGCATGGTATCTCATGTGCTACGCCCGCTCCG
CGATTTTGCACCGAGTTACTTCGACGACATCTTCGTACACGGTCGCGCTGAGGGAGGCCTCAGCGCGCTTGAAGTCCACTTGAATCATCTGAGGCAAGTC
TTCCAAGTGATGCGCGAAAACAAGCTATATGCCAACTTGAAGAAGTGCATATTCAGCGCGCCGGAGATTCCGGTGCTTGGCTGCTTTGTGAGCAAGAACG
GCGTCCGCGCCGACCCCGAGAGAGTGTCGTCGATATATGCGTGGCCTACGCCACAGCATCCCACTGAATTGCGTCAGTGGCTAGGTCTCACAAATTATCT
CCACAAGTACACAAATAATTACGCCGGATTGATCCAGCCGCTCTCTTCGTTGTTGAAGAAAGATGTGTCGTGGTCGTGGACTTCCGCACATCAAGCTGCC
TTCGACTCGGTGAAGAAGAGGCTCGCCGAGGCCCCAATCCAAGCGCTCCCGGATGACTTGAAGCCCTTTCACGTCGTCTGCGACGCGAGCGATTTCGTCA
TCGGCTGTACGCTGATGCAATTCAACGATGAAGATCGAGAGCGTGTCGTGAGCTACCAGGCCAGACAGATGAAGCCGGCGGAGCGTAATTACCCTGTTCA
CGACAAGGAGCTCCTTGCGATGCGCTACGCTCTGATCAAGTTCAGAGTGTACTCGTTGGGTGAGGATACCTTCGCGGTGTACACCGACCATGCATGGCTG
AGGACAGCGATGAAGAGTCCCTGTCTATCCCAGCGGATGGTCCGCTGGCTTACATTCTTCTCTGAGTACAACTTCGTGGTCCATTACAAGCCCGGCAAGA
ACAACTTTCTCGCCGACGCTTTGTCTCGGTGTCCCGACTACGACCCACGTGGTGCACTGGTTCGACAAGCTTCGCTCGATGAAGACGATGTAGACGAGTG
TACCACGTGCGAGGCGTCAGGGGTCAACCTGACGAGCGTCTCCACGGTAATGCCACTTCGCGACGAGATTCGAGCTGCTTACGAGTATGACTCGATGTAC
TCCAGTATTCTGGAGCATCTCCGCTCCCCCAGCGCCGACACACTGGGAGACCTTTCCCGCTCTGTACGAAACAAAATCCACCGATATTGTCTCGAGGACG
AGCTGCTGACGTACAGCATCGACAACTTCGTTTGCTGCACATGTCGCTGTGCCTAACGACTCCGATCTGCGCTCACGGATTATCCATGAGTTTCATGATG
CCCCGCTGGGCGCTCATCTCGGTCGCGAGAAGACGTTTGCCGCTGTGTCACGCGACTTTTTTTGGCCCCACCTGTATAAATGGGTGCGTAAGTGGGTGCA
CACCTGCGAGATCTGCCAGTGCGTGAAACCTGCCTCGTCTTCGCAGGATCCATTGCGTCCTCTACCAGTGGCCACCGAGGCCTGGCGCTCGGTGTCGATG
GACTTCATCTTCGAGCTCTTACCGATGCTAAAGGACGTTCAGGTGTCTTGGTGTTCGTAAACCGCTTCAGCAAAATGGTCTACCTGATTCCGGTGTCGGA
TTCGATCACCGCGGCAAATACCGCAGTGCACTTCATCGATGCAGTCTTCCGCCATCATAGCCTTCCTGAATTCATCGTCTCCGCTTCTCGTCGGTCTTCT
GGTCGAAGCTCTTCCAGCTACTAGGCTCGAAGTTGTTGATCTCCACAGCAGCCCATTTGGAAACAGGCGGCCAGACGGAGCGCGTAAATCGCGTCCTCGA
AGACGTCCTTCGAAGCTACGCGACGTCGTTCTCCAGCTGGAGCTCGTTTCTGCATCTGGCCGAGCTCGCGCTGAACAACGCGGTACACGCGTCGACTGAG
CTGACGCCCTTCTTCATTAACAACGCGTGACACCCGCGTGTCCCTGCTCTCCTCGCCGTGGGCCATCCCACAGCGCCGTGTGTCTCTACTCTGGGTGGGG
AAGAAGCTGCCGACAAGTCGTCTACTCC