Description :
From Genome Similarity Track
Location :
scaffold_1355:4058- 5340
Sequence
1282 bases(100 bases per row)
CGGCAACATCTTGAAGAACCTTGTACGCCTCACCCCGCTCGACGACGGTGCGGGATAGTGCTGCGACATCGTCATCACGGTGCTGAGGGGAGGCGTGCGA
AAGGCCGGTTCAGAATCGGAACCAGTCTCGAGAGAAGTTGTCAGGTCAATGATCGAGCCGTCTCGATCACTTCTGACCCCAGGAGCGCTGGTTCCTCTAA
CCGGCGACTCAGCGGACGCCTCCACGCCGTGGTTAGCTGGCGTAGGAGTGGCTGGCGAGGTCTACAGTGAAGAGAGGATATGTTAGAAGGCGAGGCATAC
ACTACCGAGATCAGGGATGAACGTACCGAGGGACCAGGTCCTGCAGAAGGCGTAGCCATGGTTGTACAAGCGGAGAGGCGTCCAACGGCGAGAAGTCGGC
GGTGTGAGACGGAGAATAGCGAAGATGGGTTTTGACACTCACCAGCTCAGCTCGTAGCAGTTGTGATGTAGGGGACACCAGATTTTATCTCGACTGAGAC
TAACGACTGGTGTTCCATGGTATACACCAGCCGACTCGACACTGATGTCTAAAGATCTGTGATCCACGGTACGAACTCGACTAGAGTGGAGTCTAAGGAA
CAAGGACCCACGGTATGTACACAGTTGCCGAGCCCGTACAAGAGGAAGTCGGCCAAGCGGACTCAGCCGAAGAGGCATCAAGGATCAGATATTAGGGTGC
GACACGGGGACGAGTCCAACAGTCGACAGCCAAGCGCCAGACGGGTCGGCTGAAGAGTCGTCAAGATCTGTAACGACTCTATTTTATTTGATATTTGTAT
AGGAACCAATTAGGAATTAGTGAAGGGGCATTAAGTCCCTGGAACATAACAGAGCAAAATTTTCTAGGTCCAACACAAGTGTATACTCTTTCGGTAAGTC
CCTGCACGGGCCGGATTATGTCTGCCGTCAGAACCCGATTGTAGGGTTCTGACTGGTAGTGCCAAAGGAACAAGTTGGCCGGGGAAGGGCGTGTCTCGCT
ACGCACGAAGAACAAATCCCGCCAAGCTCGGCGGGTCGGTACGCCGTACAGCCCGGGTACCGTTACTCTTCTAGCCGAGTAGCCTTTGCCTCGGCGACCC
GTAAAAGCGCTAACACGCCGTCGTCCATCCTTTGGTGGAGGGCACAGGATTTACCACTATTGGCTTGGTTGGTTGGTACTCGGTGGAGGTGAAACATCAA
CTGTCCCGGAAGGGCCGAACCGCTAGGGGACAACCCAGCGCAGGCCGACAAACGCCGACTTGACTCGGCGATTGTTGTGGTT