Description :
From Genome Similarity Track
Location :
contig_29:405799- 408662
Transcript NameFunction/comments
g7163.t1hypothetical protein

Sequence
2863 bases(100 bases per row)
TCCTCGTCAAAAATGCCAATCGCGATGATTGGCAACGCCAAGAAGAAGTTCCACCCAGCCATAACAAAACTCTCAAACACGCTCGTCCCCGACTGTCCGT
TGTAGAAATTGAACAGGAACAACGCGATGACGAGCGCGACGTTCTTGTAGAACGAATAGAGAATGACTTTGGAGATCCGCTGGTAGTTGTAGCGCCCGTG
AACAAGGAGAAGTCGCTCGAGGAATCTGAACTGAGCGATGGCATAGTCACTGGCATTCACAGCTTGGACACCCTCTTGGCCCGACACACCGATACCCACG
TGAGCTGACTGAATCATATTCACATCGTTTGCTCCGTCCCCAATAGCCAGCGTGATTGGCTTTTGTGGAGAATTGTACCGAATGAGGTTGACTATGTCTG
CTTTCTGAGCAGGGGAGACACGGCACGCAATAACGGCTTGGCAAATGCTCGATATGTCCAAGAGCATTTGCGAAAGTACCTTGGCTGCATGCAATGCCCG
CTCGGACGACGTGTTCTTGGGTGGGAACACGTGTACCATGGCCTTGCCATCGCACACAAGAGCAAGGTGGCTTGAAACCTTGTTAGCGTTCATATGTGAC
TGCACATCTTCTAGCTTGTAGATATTGTCAACTTGTCTACCCAAATCGTCCAGATCCTCGCAGTTGATGATAAGAAGCCGCATTCCTTCATTGATCAGTT
GGCAGGCGTGCCCGATGTTAATTGCGGTTTCCTCCTTGTCACCTGTAAGCATCCAGATCTTGATACCCGCTTGAGCCAGGTTCGCAATGGTAGTAGGGAC
ACCCGCCTGCAGTTTATCTTCAATTGCTGTTGCCCCCACAATCTTCATTTCCGTCTCGATCAACTCAGCAACCTCCTCTAGCAACTCGTCGCGATTCGTC
AAAGACGTCACGGCTTCCTGGTACTTGACGTCCCAAGCCAAGTACTCTTCCTCTGCCAGCTCTTTGCTGCTTATCACTAGCGTCCGAAGCCCTTCACTTG
CAAACCGCTTCAATTCTTCATCCATTTTCAAAGTATACTGGTCGCTTTTGCTGCGAGGCATCATGACGTTGTCTGCCCCCTTGCAATAGAGAAAGTAGCG
GCCGTCTTCGGTCCGAATTGTCACGGACATCCGCTTCCTCGTGCTGTTGAACTCATTCACGTTGAGAATGGTGTACTTACGCACAACTGATGAGCCATTC
TTTTTGGTTACCTCGACCTCCAAAAGTGGCGCCGGAGCGTAGAAGTTATACCCCAAGCACTTGGCAGCTTTCACTAAAGCTTCTTCGTCCGGTGACGAGG
CACGGTAGTCAACTTCTCCCGTTTTCGCGTTCTTCTCCGGGATCACCGTGTGGCAGACAGACAGCACCGTGAGGAACTCATCGATGGCGGCAGCTTCCGG
GGCATTCGAATCCAGCGCATTAATTAAGCGCGGATCGTCAAAATGAATGAGTGGGTTGAAGTCTACCTGTGCGTCTCGGGGCTCATGTGTTTTTTCGTCG
TCGCCTTGGTCGTTTGTATCAGCGGAACCACTCGCCAATCCCTTAGCGGCTGCATTATTCCTCGCCATTTCTGCAACAGCACGGCCGATCTCGGTTGTAC
CATATCCATACGACACGCCAGCAATGAAGCACTTCCGAAACTCCATGATGTTACACGTGAGCGTGCCCGTTTTGTCGCTGAAGATATGATGAACCTGCCC
AAGCTCTTCATTCAAGTCAGATGTGCGTGCGTTTGCGTATGTTCCCTCATGACACATTTCAGGGTCGCTGGAGATGTATTTTGCCTGGATAACCTTCACC
ATATCGAGCGAAACGTACAACGAAATCGGGACAAGGTTGTTATACAGGATGAGAAACGTGAAAAAACTCACCAAGTTGGAGGCGGAAGACGTTCGTGCAA
TCGCCGAGCTAAAGTACCAGAGGTTTGTTTCGTACTTGTCCATCCAGATCGTGTTGCAAATGGTACTGATGATGCAAAGCACAAATTGCGTGAGGAAGAT
CAGAATAATGCAGCGGTTCACCATCCTGTACACGTTGCTCTGCTTTGATGGCGTCGAGCGTGCATTTTGCATAAGCTTCGTTTCCGAACCCGTAAAAATG
ACGATCCCGTAGATATACGCACAGCCGCGTACACTGCAACCACGCAGGATGATGTTGGAAGGACCAATTGGGGCTGCTTCCTTGTTCGGTCCAAACTCGA
TGCGGCCCGTGAAGTTGTAAAGTCGGTTATTCGGCTCCTCGTACTCTATCGTGGCGCTGAGCTTCATCATCTGCTTGCTGTGCTCTGCCTCCGGTAGTAC
CGGATCGTTTAAGTTCCTGTAGCCAACATGCTGCGCCACCGGTTCAATAGCCGATCGTCGCTTTAAATTCGTCTCCCCGTCCAAATTACAAGTCTCGACA
AAGCATCGGCCTTCTTCCTCTGATGTAGACATAATGAACACGTCGGCCGGAGCCTCGTCGTGGTCACCGAGGCGCAAAATATCCCCCACCACAACTTCTT
GCCACTCTTTCGTGACGATTTCTCCGTGACGCCCCAACACTTTACAATGTCTCGAGTTTTGGACGTTGTCAGCGTCGTGGCGTTTTTTATCCTCCACGCC
CTGCTTGATCATAGAGACCATCAACACGATCACCAAGGGCCCTGCCGTGGTGTACTTGTTGGTTGGCGACCACGACGTAGCCACTTGTAGTATCGAGATC
ACCAGGAAGTAGCAATTGGCGATCACGCGGAAAAATTCGAAAAGCATCTTGGGGACGAAGCTCACAAGTGTGTACTTGGACGTTGTCACGTAGTTGTCCG
CGTATCTTCCTTCGCGCCGCAACCGTTCGTTGTCCTCGTCATTGTTGAGGTGGACCCTGCGGA