Description :
From Genome Similarity Track
Location :
contig_29:405792- 408655
Transcript NameFunction/comments
g6834.t1hypothetical protein

Sequence
2863 bases(100 bases per row)
TCCTCGTCAAAAATGCCAATCGCGATGATTGGCAACGCCAAGAAGAAGTTCCACCCAGCCATAACAAAACTCTCAAACACGCTCGTCCCCGACTGTCCGT
TGTAGAAATTGAACAGGAACAACGCGATGACGAGCGCGACGTTCTTGTAGAACGAATAGAGAATGACTTTGGAGATCCGCTGGTAGTTGTAGCGCCCGTG
AACAAGGAGAAGTCGCTCGAGGAATCTGAACTGAGCGATGGCATAGTCACTGGCATTCACAGCTTGGACACCCTCTTGGCCCGACACACCGATACCCACG
TGAGCTGACTGAATCATATTCACATCGTTTGCTCCGTCCCCAATAGCCAGCGTGATTGGCTTTTGTGGAGAATTGTACCGAATGAGGTTGACTATGTCTG
CTTTCTGAGCAGGGGAGACACGGCACGCAATAACGGCTTGGCAAATGCTCGATATGTCCAAGAGCATTTGCGAAAGTACCTTGGCTGCATGCAATGCCCG
CTCGGACGACGTGTTCTTGGGTGGGAACACGTGTACCATGGCCTTGCCATCGCACACAAGAGCAAGGTGGCTTGAAACCTTGTTAGCGTTCATATGTGAC
TGCACATCTTCTAGCTTGTAGATATTGTCAACTTGTCTACCCAAATCGTCCAGATCCTCGCAGTTGATGATAAGAAGCCGCATTCCTTCATTGATCAGTT
GGCAGGCGTGCCCGATGTTAATTGCGGTTTCCTCCTTGTCACCTGTAAGCATCCAGATCTTGATACCCGCTTGAGCCAGGTTCGCAATGGTAGTAGGGAC
ACCCGCCTGCAGTTTATCTTCAATTGCTGTTGCCCCAACAATCTTCATTTCGGTCTCGATCAACTCAGCAACCTCCTCTAGCAACTCGTCGCGATTCGTC
AAAGACGTCACGGCTTCCTGGTACTTGACGTCCCAAGCCAAGTACTCTTCCTCTGCCAGCTCTTTGCTGCTTATCACTAGCGTCCGAAGCCCTTCACTTG
CAAACCGCTTCAATTCTTCATCCATTTTCAAAGTATACTGGTCGCTTTTGCTGCGAGGCATCATGACGTTGTCTGCCCCCTTGCAATAGAGAAAGTAGCG
GCCGTCTTCGGTCCGAATTGTCACGGACATCCGCTTCCTCGTGCTGTTGAACTCATTCACGTTAAGAATGGTGTACTTACGCACAACTGATGAGCCATTC
TTTTTGGTTACCTCGACCTCCAAAAGTGGCGCCGGAGCGTAGAAGTTATACCCCAAGCACTTGGCAGCTTTCACTAAAGCTTCTTCGTCCGGTGACGAGG
CACGGTAGTCAACTTCTCCCGTTTTCGCGTTCTTCTCCGGGATCACCGTGTGGCAGACAGACAGCACCGTGAGGAACTCATCGATGGCGGCAGCTTCCGG
GGCATTCGAATCCAGCGCATTAATTAAGCGCGGATCGTCAAAATGAATGAGTGGGTTGAAGTCTACCTGTGCGTCTCGGGGCTCATGTGTTTTTTCGTCG
TCGCCTTGGTCGTTTGTATCAGCGGAACCACTCGCCAATCCCTTAGCGGCTGCATTATTCCTCGCCATTTCTGCAACAGCACGGCCGATCTCGGTTGTAC
CATATCCATACGACACGCCAGCAATGAAGCACTTCCGAAACTCCATGATGTTACACGTGAGCGTGCCCGTTTTGTCGCTGAAGATATGATGAACCTGCCC
AAGCTCTTCATTCAAGTCAGATGTGCGTGCGTTTGCGTATGTTCCCTCATGACACATTTCAGGGTCGCTGGAGATGTATTTTGCCTGGATAACCTTCACC
ATATCGAGCGAAACGTACAACGAAATCGGGACAAGGTTGTTATACAGGATGAGAAACGTGAAAAAACTCACCAAGTTGGAGGCGGAAGACGTTCGTGCAA
TCGCCGAGCTAAAGTACCAGAGGTTTGTTTCGTACTTGTCCATCCAGATCGTGTTGCAAATGGTACTGATGATGCAAAGCACAAATTGCGTGAGGAAGAT
CAGCATAATGCAGCGGTTCACCATCCTGTACACGTTGCTCTGCTTTGATGGCGTCGAGCGTGCATTTTGCATAAGCTTCGTTTCCGAACCCGTAAAAATG
ACGATCCCGTAGATATACGCACAGCCGCGTACACTGCAACCACGCAGGATGATATTGGAAGGACCAATTGGGGCTGCTTCCTTGTTCGGTCCAAACTCGA
TGCGGCCCGTGAAGTTGTAAAGTCGGTTATTCGGCTCCTCGTACTCTATCGTGGCGCTGAGCTTCATCATCTGCTTGCTGTGCTCTGCCTCCGGTAGTAC
CGGATCGTTTAAGTTCCTGTAGCCAACATGCTGCGCCACCGGTTCAATAGCCGATCGTCGCTTCAAATTCGTCTCCCCGTCCAAATTACAAGTCTCGACA
AAGCATCGGCCTTCTTCCTCTGATGTAGACATAATGAACACGTCGGCCGGAGCCTCGTCGTGGTCACCGAGGCGCAAAATATCCCCCACCACAACTTCTT
GCCACTCTTTCGTGACGATTTCTCCGTGACGCCCCAACACTTTACAATGTCTCGAGTTTTGGACGTTGTCAGCGTCGTGGCGTTTTTTATCCTCCACGCC
CTGCTTGATCATAGAGACCATCAACACGATCACCAAGGGCCCTGCCGTGGTGTACTTGTTGGTTGGCGACCACGACGTAGCCACTTGTAGTATCGAGATC
ACCAGGAAGTAGCAATTGGCGATCACGCGGAAAAATTCGAAAAGCATCTTGGGGACGAAGCTCACAAGTGTGTACTTGGACGTTGTCACGTAGTTGTCCG
CGTATCTTCCTTCGCGCCGCAACCGTTCGTTGTCCTCGTCATTGTTGAGGTGGACCCTGCGGA