Description :
From Genome Similarity Track
Location :
Scaffold_89:40577- 43641
Transcript NameFunction/comments
Phyca_LT153421290P-type ATPase (P-ATPase) Superfamily

Sequence
3064 bases(100 bases per row)
tgctccaatgtggtgattacgtccaagtacacgacgtggaacttcctgcctctgttcatgctcgagagcttccggaaactggccaacgcctactttttgc
tggtctccatcctccaatgcatcaagagtatcagtaataccaacggtctaccgtccaatctaccggttttggtcttcattctggctgtggatggagttct
ggctgttattgaagaccgcagacgacacctggcagataaagaggccaactcggctcaatgccacgtacttaaggagacgtttacaggcaccaatgacgca
cttaaccgagctggaggcgtggatgatccggacattgcgctcatgcactgggcagctcttacggttggctctgtggtgaagctgcacaaccgagagacgg
ctcctgccgatctgcttattctagcagttgcagagccgaatccaagtgaacctgcaggcatctgctacgtggagacaaaaagtctggatggcgagacgaa
cctcaagctgcgtcacgcctgtgacgctacgctgcatgtgcggacggcggcccaagtggctgctctcgcgggtcagttacgctgtgagaaccccaacaaa
gccattggacgcttcgatggcactttatccgtcacagaaggaaccaaagcgacagagacccacccgcaaccgatcgctatcaaaaacgtgctgcttcgtg
gctgccaactgcgtaacacggactggatctacggcctcgtggtgaacactggtccagacacgaagatcatgcagagcgccaccgcgacgcgacccaagtg
gagctccattaacatgacggtgaacaagatgatcatctggctcttcctgctgctgtgcttcctgtgtatcattgcaacgacggtgcaggtgatctggctc
aacagtaacatcgacgagagctggtacctggactggtcccccagcatcacgagtcagtggttcatcggcttcggctactacttcctgctcatgtaccaga
tgattcccgtgtcgctgtacgtgacgatctcgatggttatgttcatccaggccatcttcatgacatgggacctggacatgtactacgaggaagcagacgt
gcgtatgatcgttcgatccatggggctgaatgaggagctgggacagatatcatacgtctttagtgacaagactggcacgctgacgtgcaacgtcatggag
ttccgcaaatgctcgatcaatggtgtgtcatacggcacaggaatgacggagattggccgcgctgcgttgcgccgaaagggtgttgcggtgccagcagaga
cagagccagacccagccacgcagcgtgccaagatcccgtacgtcaacttcgaggatgtgcggctgtttaacgcgctggagaagcctatcagtgatgacac
gccgaaccgagaagctgagttcttcttgcacctgagcttgtgccagactgtcatccctgaagcggtggaaggcagcaatgaagtgcgtttttcggcctcg
tcacccgatgagcaggcgctggtttcaggtgccaaattcttcggcttcagctttgaatcccgcggcctgggtgttgcccgcgttcgtgtgaagcgcccgg
aactgatccgccgctatgcaaacggtgtgactggatcgaacgtgctgttagagttcaagatcttggatgttctagaatttacgagtgaccgtaagcgcat
gtcggtcgtggtgcagtacccgaacggagaatactgggtgctcacgaagggtgctgataatgtgatctaccccatgctggcgaagggaaagagcgatcct
gagatgatgaaggagacgatgcgtcatttggagacctttggagacgatggactgcgtacacttacgattgcacagcgccgtgtggacgagaaggagtatc
tgaactggagcgcacgcttcaaagaggccaactcatctctagaagagattgacaagcgtaagaacggccaggataacgagattgacaagctgatgacgga
gattgagcgcgacctggagctgctcggcgctacggctattgaagacaagctgcagaacaacgtgccgagctgcattgccaacctaatgcgtgctggcatg
cgtgtctggatgctgactggtgacaagcaggagacagccattaatatctcatatgcctgccagctcatggataacgacatgcagcagttcatcttcaact
gcgacttataccctaccaaggatgcgatcttctcgcatctaacagaggcgaacgcgcaggtccaaggaggtagtggccgccacgccgtggtaattgatgg
agagtgcctggaactaaccctggcggacgacagatgtcaacacgaattcctttctttggcaatggcctgtgatgcggtggtgtgctgtcgtgtatcgccc
agccagaaggccgaggtggtgacgctggtacgcacaaccaacaagaaggctcggacgctggctatcggtgacggagccaatgacgtggctatgattcagc
gtgcacatgttggcgtgggtatttcgggccaggaaggcatgcaggctgtgaactcgagtgactatgctattggccagttttacttcttggagaagctgct
gctgcaccacggtcgattgaattacaagcgcatgtccatccttgctggttacatgttttacaagaatatcgtgatggtgctggcgcagtacttttacatg
ttctgcacgggctcttctggccagaagttttacggggagttgggcttccagctgtacaacatttgctacacttcgctacctatcatcgtgctgggcgttt
tcgactacgacgtgcctttcgaggtgagcaagcactttccggagctgtacctggtgggacctcgcatggagctgttcaacaactacacgttcttcaagtg
gatttgtagcgctgtttatgagtcagctgtcatctttgtcttcgtggtctacgcattcaacgagaatctctccaacgctggtagtgcccctatggtgcag
tacggattgctggcattcactatggtggttttggtggccaacatcaagctgtgcatgctgcaga