Description :
From Genome Similarity Track
Location :
Scaffold_877:4057- 5363
Transcript NameFunction/comments
Phyag_g8499hypothetical protein
Phyag_g8500hypothetical protein

Sequence
1306 bases(100 bases per row)
ACGGAGAAACGCCAAAGACCATCTACAAGCTTTTGGAGTTTGAAGGGAAGGGGCCGGTTGTTATGAAAGACCCGCGCTACATTGAGTACCTGGAATTCGC
AAAGCTGTGGCGAGCGAAGAAGGGTACGCTAGCAAAGGAGTCGTGGCAGTTCTGGAAAAAGAATGCATGGTAATACCAACCAAGTTATCGATCAATTGAA
TGGTACTTTTGCTTGCACTCTAGTTAGCCCTAGTTGCTGGAAGGCTCGGGTGGTACTAGATGGATACATTATGTGAAAAATGATGTGGTAGTCatttttt
catttttttttcgtgCGGCCAATTATTTGACGCGAGGCCATGTCGAATATCTATATTACGGAGCCCAATACGGAgggcaaggtgctgctgcatacGAGCT
TCGGGGACTTGGACGTGGAGCTGTGGCCGCAACAGGCGCCGAAAGCATGCCGCAACTTTGTGCAGCTCTGCTTGGAGGGGGTGAGATACTGGCCAGTGCA
AATTTTGAGAAATCGAGTTATTAACCGCTATGTTTATGATATGACAGTACTATGACCAAACAATTTTTCATCGCATCATAGCTGGCTTCATGGTGCAGGG
CGGAGACCCCACGGGCACCGGCAAAGGAGGCGAAAGCATTTATGACGGCGCGTTCATCGACGAATTCCACTCGAGACTGCGATTCAACCACCGCGGACTC
TTGGCAATGGCCAACGAGAACAAACCCAACACCAACCACTCGCAGTTTTTCTTCACGCTGGACGCCTGCGACTTCCTGGACAAGAAACACACCATCTTTG
GCAAGGCACGAGGGACTTTGGGGCTGCTGGAATGGCAAAACAATAACTTCtaactttttttttcctgATTTGTTTTTAGGTGACTGGCAACACGATTTTC
AACTTGTTGAGTGTTGGGGGTTTGGAGACGGATGCGAACGACCGTCCTACGAGCCCGCCAAAGTTGTTGAGTGTTGAAGTGCTATGGAACCCGTTTGAGG
ACATCGCACCGAGGTTAGGTGGAATATGATGTGTTTTTGTAAAGGTGATTTTGTAGCTGATGGAGTGGTTTGTGTGGTGTGATTAGAGCTGTTAAGAGGA
aggaagcagcaaatgctgaTGAGGctcaaaagaagaagaaacgtgAGCGAAAGGCGACGAAagacttgaagctgctttcGTTTGgggatgaagaggaggc
tTTTCAGGAAGAAATTGATGGCGGGGCCAAGAAATCCAAAAAGAAAAAGGCGAAGACAATGATAAGCAGTCATGATTTACTGGATGATCGCAAGCTGAAG
GCGGAA