Description :
From Genome Similarity Track
Location :
Scaffold_10:405675- 407557
Transcript NameFunction/comments
Physo_249180putative peptide transport protein

Sequence
1882 bases(100 bases per row)
CGCAGGCGTGCTGAGCCCGGCGCAGCTCGCTCCTCCGGCCGGGGCGTCCCCAGTCGAAAGGGAAGCTCATTTCTCAATCGGACCTCAAGCGCGCACTTCG
ACAAGGAACTCAAGAGACCGCCATGGGAGTCGCCATCAAGTCGCCCATGGGCTCGCCCGCGGTGCCCTACGAGACCGTGCAGACCGTGTGGGAGGCGCGT
CCACGCAAGTACAAGAGCGTCCTGTTCCAAGTCTGCCTCTTCATCCTCATGATGGAGCTGGCCGAGCGTCTCAGCTACTACGGTATCAGCCAAGGTCTCA
AGAACTTTATGCAGGAGATCGGCTGGAGCCTGGTCTCCGCCAGCGCATTGAAGAGCACCTGGACGTCGATCTGCTACCTGACCCCGCTGTTCGGCGCCTA
CCTGGCTGATGAACGGTGGGGCCGCTTCCGCACGATTTTGACGTTCGGCATTTGGTACTGCGTCGGTGACTTCCTCGTCGCTATCGCCGCGTACCCGTCC
ATTATGACCAACTCGGCTGTTGTGAACCCGATCTTCGTCATCGGTCTCTTCGTCGGCATTGGTGTTGGTACCGGTTGCATCAAGTCCAACGTCATCACGC
TTGGCGCCGACCAGTTCGACCCGCATGACCCGAGTGAAGTCCACCAGAAGGAGACGTACTTCTCGTACTTCTACTTCTGCATCAACCTCGGCTCCGGATT
TTCGTACGGTTACCTGTCGATCCTGTGCGTGGATGGCTCGGCCCAGATCCCCGCGGAGTACGGCTACTTCGCCACGTACATGATCTGCGCCGTGGTGATG
CTGTTCGCCATTGCGATGCTGTGCGTGGGCTACCCTCGCTACGTCTTCATGCCACCGAACGACCGCTCCATCTCGATGCTGTGCAAGCTGGGCTGGGCCA
ACGCCAAGCAGACCCGCAGCGGCTTCATCCTCGTGTCTGCGACTCTGAGCTTCCTGGCTGCTCTGATCGTCAACGTCATCTCCGCCTTTACGGTTGATAA
GGGAAACACGGGCAACATCCTCTCGTACGTCGCTGCTGTGCTGGTGCTTGCCGGCATTATCGGCTGGGTGTACTCCGGCCAGGAACAATCCTTCCTGGAC
GCGTCAAAGGTCAGCCATGGTGGCACCTTCGACGACGAGCGCGTTGAGGGTTACAAGAAGCTGGTGCGCGTGCTGCCGTACGCCGCCTTCACTATTATCT
GGCAGTGTGCGTATGACCAGACCGACGCCAATTTCCAGTCCATTACCCAGCAGTGCGACCTGCGTCTTGACACGAGCGACCCAGACAGCTCGCAGATCCC
TGGCGCCATGCTCGGTGTCTTCGACCCGATCGTCATCGTCATTGTCATTCCGATCCTTGACTCGATCGTCTACCCGGCGTACTCCAAGTGGGCCGGCAAG
TCTCCCAGTCAGTTCGGCAAGTCCGCAACCGGTCTCGTCATCGCCATCGTTGGCATCTTCTGGGCCGGCATCTTCGAGGTCATCCGTCGCAACGCTGGAG
CTCTACAGGACGAGAACGGGGACCCCATTTTGGATGGAGGTAGCTCTCAACCCATGAACGACATCTCGTGGGCCGCCGCCATCCCCAACTACATCTTCAT
CGGTCTCGCTGAATGCCTGATCAACGTTACGGCGTACGACCTCGTGTACTCTTCAGTGCCGATGTCGCTCAAGTCCATGGCCCAGGCCGTGATCCTGTTC
ATGAGCTCCATGGGCAGCATCCTCACCTCGGTCTTCACCATCATGTTCTCCAAGTCGCTTCCGTCCGACAACCTGAACGAGGACCACCTCGAGAACATGT
TCTTCACGGTGGGTGCCGTGAGCGTCATCAACTTCGTCTTCTTCATTATCATCATGCGCAAGATGAACATGGGCATGTCCTC