Description :
From Genome Similarity Track
Location :
Scaffold_1:405564- 442893
Transcript NameFunction/comments
g133.t1GAX99613.1 cysteine protease family C01A, putative, partial [Pythium insidiosum
g134.t1XP_009515539.1 hypothetical protein PHYSODRAFT_248465 [Phytophthora sojae
g135.t1hypothetical protein
g136.t1hypothetical protein
g137.t1hypothetical protein
g138.t1hypothetical protein
g139.t1RAW31858.1 Dynein alpha chain, flagellar outer arm [Phytophthora cactorum
g140.t1XP_008909588.1 obg-like ATPase 1, variant [Phytophthora parasitica INRA-310
g141.t1hypothetical protein
g142.t1OWZ24325.1 hypothetical protein PHMEG_000643 [Phytophthora megakarya
g143.t1OWZ24326.1 hypothetical protein PHMEG_000644 [Phytophthora megakarya

Sequence
37329 bases(100 bases per row)
TGGTTAACCGTGCTTTATTGTTTCGATGGATCAAGTATGAAGCTACATGAGGTCAAATGCGCTCGTCAGAGTGTCCGGACGACACTATCCTCTCACACAA
GCCAGATGCCACAAGTCACCACCCTAGCGGGCCGCTGTCTGAGCGGCGTTTGTCGGAGTACGGGCTGCGTACATGGCCGAATTCTGTTTCCGGAGGGTTT
TGAGCTTCCGTTGTGCAATGAGCATGCCGATGGCAGTCGTCACCACCGTGAAGATGGTGGTCACGGCAGCAACAGCGATCCAAGTCGTAGGACTCAAGCC
CATGAAGACCTTGTCACCGCCGCTGTCTACGCTAGTGCTCGCTGCAGCGCCGGCCGACGCACCCGTGGGGATCACGGGGAAGATGTTGAGACCGCAGTTC
ACCTTGGCATCTGCTACCAGCTTCAGGAAGCCACTAGCACCCCACGAGCTACCGTACGAGTTCTTCAGGATCCAGTAGTCCCCCTCTGTGGCATCGGTGC
CGTAGCCCACAAGTAGCAGAGCGTGGTTCACGTCGTCCTTCGAAGAGAGGTCACCGTCGTTGGGGCAGCTGTAGAAGCCTCCGGCATAGTCGCCGAACGG
ATCTTCCGAGTTAATTGCGACTGCAATGGGCTGCTGCTCCACCGCTGTACGCAGCAAGATCGTGCAGTTGCTCGAAGCCGCGCAGTCTGTCCCCACGACC
TGCTCCCAGCCCGTGATACTTGCAGCCGTCTCGTTGGAGCTCACCGTGCACGACGACGAACCATTGTTGGAGGACGAGGTTCCTGAGCTCGAGTCATCGT
ACGGCATCGTGAGCTCTGTTACGAGACCCCACGAATTCTGGGCCGCGTCGATAAAGGCGCCGTGGGTCATACCACCATTGCAGCCGTCATTCTGCGACTC
CCACTTGATCTCCGTCTCCATCCAAGTAGCACCGTCCACGCCGCTGTCCGTTGCCCAGCAGTAGTCGAAGGTCTGCGTCGTCTCCAGCGTACTGCATGTC
AAAAACTGCTGCGGCGAGAGTGACACAGCTGCCGACGCGTTCTCGGCGATCGCGACCGCCGTCTCGATGGCATCCGCGGCAGCGAACGCCCAGCAACTGC
CGCAGTTCTGTTGACTCTTGACAGACGAACACACGCTGTAGCCGAACGAGTTGTCCGTGTCGCACCAGTTCCAGTACTCGGAGCTGCCAGAGCTCGACAC
GGTGCTGGTCGCAGTTGCGGTGCTGCCGCTTGCCTCTGATACTAGTCGACGGGAGCGCGCGGCCTTGGCCTCCTGGTCCACGAGTTGCTGGGGCGAGAGT
TTGCGCCGGGGGGACGACGTCAAGTGGCGCTCGTTCACGCCCATATGATACGAGAAGTCGTGGCCCACGCTCTTGGCATACATGAGTACGTCCTCGATGT
AGGTCATGTGTGCCTGCAGGTTGCGGCGGTAGGCGTCCTGGTCGCGGAAGGACACGAGGTTGCGCTGCACGAGCAGGTCGCGCAGGGTCTTCGAGTCGAC
GACCTCGCTGTTCTCGCCCGCCCAGAGGCACGGCGAGTCGGCTGAACGCGCCACGGGGCAGTCTACGAGCGCACCGAGAGCTCGCTCCGTCGTCTGCGCA
GCAGAGCCCCAGCCAGCGGCCGCGGAGAGCGCGAGGAGATACACAAGCATACCGGAAGAAGGGGTAAATGTGTGGGACTGCCCGCTGTCTCTTTCGGAAA
TGGCCACAATTATGGTTGTTTTGCTACGTTTCAACGAATGGTATAATCTGTATAAATGCGTTCCCCGGCAAAATGAGCATGGTCTGTTCGGTAAATAATC
CAAGGTTATAGAACTTGCACACGGATTTGTATGACTTTAGTGCATGACTTTGAATCAATATATAATCAATTTGCGAGGTAATAAATACCTGCGGGTTTCC
CGTACGAAATTGGCTTACTACAATTAAAGCATGAAAACAGCGTTTTCGGCATTTCATGTGATTCTACATGTTTCGCGTATTCACAGAAGCGAAGTCTGTT
GCCAGCCTAACGGCCAGGGCATGCTACGCCACCTTTCGATGCTGGTTGCCCCACCTCTTTAACGGTAGGAAGTCTCACACAAGCTACCGTTAGAGCCCGC
AGAGCAATTGAGTCACACGGTCTCAACCGTGTGACAGGACCTACTTTTTGGGTTGGCTCTTAAAATCCAAGGCCTGACTCATTACTGAGATTGAGATTGT
GTGTCTGCAGCCCTTCTTGTTGTACTCTCGAGCGAAGTGCAGGAGGGGTCCGAGCAAGTACTTCACAGCACCGCCCGAACGTTTCCTTCCGACGACACTT
GCTGAAACTTGGCGCCTGCAAGCTGCCATGCTCGGCTTGACTACCCCCGCGCGGCTAGCCTCAGCTGGCTCAGCTGTCGGCAGCAAACAAGCGTTGGATT
CGGGCAGGCTCGAAGCAGCTCCCTGGTGGTCGACAGCTGGTGCTCCGTTTTCATCTTTGCAGGCTTCGACCAAGCGGAGGCTGAAGCACTGTCGCCTTTG
CGTGCATGTTCATCGACTCGATGATCGAGGGACATGCGTAGAGGTGGTCGAATCTCGCGGCGCGCTGTGTGGCTTGAATTTTCGCAGCATATGCGGCTGC
ATGGGGACTTCTGTCCGGCCCGCTGGCCAACAAAGCCAAGCCGATTTCGCTGCTCTCGCCTAGCGCCCCGACGGTGCAGCTCGTTTGACGCGCTGCGGCG
GGCAAAGACAGTCGAGTCGAAGCCACAGCAGATCCTGATGCGTCCCTCCTCTCCAGACCACCTCAGCCACTGCATCCTCCCTCCCTCGCAGACGTCGTCC
CATTCTCGGATTCGCAGTCGAGCTGATATCAGCGTCACCTTGGACGAAACTCCTCATATCGAAATGGCGGCTCAAACTGGTGTGCAAGAGGAGGCCCCGC
TCCAGGTGAAGGCGGCGATCGAGCCGCAGTGGACGCGCTTCATCGCGGGCGGCGCGGCGTCGGCTACTGCAGAGCTGCTGACGCTGCCCATTGACATCAC
CAAGGTGCGACTGCAGGCGCAGCGCTCTGGCCCCGCCACAACGGCGGCGAGCAAACCGGTGGTGCACTACAACGGCATGCTACATGCTGCGCAGACAATG
ATCAAGCAGGAGGGCCCCGGCGCGCTCTGGAATGGAGCCACGCCCGCGTTGCTGCGCCAGGTTTCGTACACGAGCATCTGCATGGTGCTCTACGAGCCGC
TGCGCAACTTCTTCGGGGCCAACGGTGCACAAGGCAAGAACGGCGAAGTGCCGTTCATCAACAAGTTCTTGGCTGGAGGTTGCGCCGGCGCGATCGGCAT
CAGCATCGCCAACCCGTACGCCTCAGCTGTATGTGCTACAGTAGTGATCGATACTGATTGACTGATATTGTTTTCTTTGGCATGTGCAGTGTGGACGTCA
TCAAGGTGCGGATGCAGGCGGACCGCTCAGGCAAGCTGTACCGTGGTGTCGGTGATGCCTTTAGCATGATCTACCAGCGGGAAGGGGTTCGCGGGTTCCT
CCGTGGCATGCCGCCGAACATCCAGCGGGGGTTCATCGTGAATGCAGCCGAGCTGGGCACGTACGACCACAGCAAGGAGTTGTTGATCTCATCAGGTCTA
CTCAAGGAGGGCGTATTGGCACATACCGGTGCCAGCTGCGTGGCAGGTTTCGCCGGTGCGGCCTCCTCCAACCCGTACGTATTCAGTGTTGCGTTTGGCT
TGGTTTGGTAATGGTGGTGTTGACAGGGTGCATTGATCTCTCCTCTTTAGGATCGACGTGGTGAAGACGCGCCTTATGAGTCAGCCAACGGACGCGAGTG
GCAAGGGGCTTCACTACAAGGGCATGGTGGACTGTGTGCGGAAAACCTTCCAAGAAGGAGGTGCGGGCGCCTTCTACAAGGGCTTCATCCCCAACTGGAT
GCGCAAGGCGCCTTGGTGCGTCGTCTTCTTCGTGACGTACGAGAAGTATCGTGCCGCGATGACCCCCAGCGACGAGGAGCTATAGACACTGTTGCTGTAG
ACTGCCAGCAAGCGCTGCTGGGTCGGCAACACATATTCTTTATGGCAGCGATGTAGCAAGCAAAGACTTCAAGAAAGGTGAAACTTGAATCGAAACCCAG
CGACTGATCATGTCCTCACCACTTGCATATATTGAATTGTTGCTTAGCTGCTGCGTACAATGGCAGGTTGCGAACTCATGCAGAGGCCACCGCCACCGCC
GACCCCGCTACCTTCCGCACATGATAAATAAGAATACATTATCCTTTCTAATGATGGCACGAGCACGTCTTTTGCGGGGGCAGAGGTGGCGTCTGGAAGC
TTCTCGTTCGCTTCTCCGTCTGCTGCCGCATGAGCTTGACACAGTAAATCTTGAATCTCTTTTCTTCGGCCGCCATTGCACTCCGTGGGCGGCTCTCGTA
CAAGCCTTCTTTTTCTTCTGATGTAATCGATTATCCATGGCCCGTTCACCACTTGAGCTCCTCGAAGTCGTGCATCTGCATGTACCACGTGGAGCGCGGC
GGTGTGAGGTAGTGCATGGTCGCCGCTCCGGGCGGCAGGCTCTGGACCAGCTTCTCGCGCAGGTCAATGAACTCGTCCGTGTGCACTACCTTGATCTTCT
CGTTGTCAGTGGGGATGGACACCTTGCCGCTCTTGGGCAGCATCACGATGGGCAGGCGCTCAATCACGCGATCCTCCGTAGACCAACGGTTGCGCGAGAT
CACGTGCACGTTGAGGTTGGAGAAGGATCCGTTCATGAACCGGTTGGAGATGGTGCTCTCCACGGACGGTACGGGGGCCTCCTCCTCCTCCTCCTCTTCA
GAGCAGTAGTAGGCCGGGCATGTACGGCGACGGCGCGCGTGCGAGTTGTTAGTGTTGCTGTTCTTAGCGAAGAGCGAGCGGCGGAAGCGGTCGCGCTCCT
GTCGGCGGCTCTCCAGCATCTCCTCGCGCGACATACGCTGCTGGTTGGCGCTCTCGCTGACAGGCACCTGGTTGTTGCTGTTGCCGCCCAAGAAGCTGCC
GTTGCTGCCGACGCTGGTGCGGCTGTTGCGATTTAGCGCCTTGAGCAGCTTCTGCAGTGCCAAGAACGTCTCGTCCACCTCCTCGTCCTCCGCGGACAGG
CTGGGGTCGTCCTCCTCGGATGGGCGACCGGCGTAGGACGGCATCTTCTTGGACAGTCGGGCGTCTCGCCTCTCGACCGTGGTCATGGCTGTCTGTAGTT
TTAGTCTCTGGTTCCCGCTGGAGACCTCTGGGTCATGTGGCAAATTGCGATATGGGCGGTGGATGGGCTGCCGTGTCTGCGACCGGAGACAGAGAAGCAG
TGTTGACGCGATGCGCTTCCTCGCTTCTTGGTGGACAGCGTGAAAGTGATTCTGCGACGCAAGTCCAGTGGCGGCTGGCGTCGAGGGTTCATAAACACGT
GGGGATCGCTTTTCGGGGGTGAACAATTTGGGAGCACTTTTCACAAAACACGGTCTTGCGCAGTCTCGAAGCTTCGAGGTGAGCTCAAACTGCACCGTGT
TTTGGAGAGAGGGCGAGGAGTCCACCCTGCTGTGGGAGTTCGAAAATCGGCTCCATAATTCCTTTTTCGTTTCGGCAACCTTGGCGGACGGCTAATTGCT
TGCTATCTTCGTCGGCCCTTGCGATGCCGCCTGGTTGCCTGCTACCTGCATGCCAGTAGCAGGCTATTCTCGTGCGTTTGCTGTTGGAAGCGTTGGATGC
CAGCGCAAAGTGAAGGTTATGGGGCGAATAGGGTTGAAAGCTGGGCAGCGTGGCACACTGGCTGTAAACTGCGATGACTGCTGTGGCTCTGGATTTGCTT
TTGACATTAGGCAACGACCCGTTGGGACTCCAGCTCGGGGGGAGGTCGCCGTTGTCAAAGCGGGCTTCGTACACTGCTCGCCGAGCAGTCATTGCTCAGT
GCAGCACTCCCTACGCAATATGATATGCGAGCCGCTGGCTGCAAGTCTATCCGTTGAGTTGCGACGTTGGCAACGGCAGGTGATGTATTCAGCCAAAGAA
GGAGCATCAGCACGGTTTGCGCACGCCGAGATCGCGCACAAGGCTGTCGCACTGGCGAGCAACGTGTTTGCTCGCCCGCCGGCAAGGCATCGACACACGA
GGTGATCTCGAGTCGAGATTCTTGACTCAAGACTTGAACTCGCGGCTAAGTACGAACGTATTTATGCGTCCGTGTTATGCCCACCACGAAGCAGCTGCTT
CAACATGCACGTAATCAGATGGAATTTAGCGTGCAACGTGTGTGTGAACTGTGTGCACCACAACGATGGTTGCCGAAGAGTCACTCGGCTGCCTGCAGTT
GCCGCGATGGCGGACCTCCTGCTGCGCTGGCTCAACCATGAGCTGGAGCTGTCGACGCACGTGACGGACGTGGAGGCGGACTTTGCCAGCGGCTACCTGC
TCGGCGAGATCCTGCACCGCCTCAACCACCAGCACAACTTCGCCGACTTTATACGCAGCTCCAGCGCCGACGCCAAGATCCTCAACTTCTGCCTGCTGGA
GCCGTCGCTGCGCAACCTCAACATCAAGTTCGACGCCAATACTGCCGCCGCCGTCATGAACGAGAAGAGGGACGCCGCCGCCAATCTGCTCTACCAGATC
AAGGTCTCCGAAGCCGTTGACAGAAGATTTATGTTCGTGAGCTCATGAACTGCTTGTGGTTTGATGCTGTGCATTGACAGATTGCTGCTACGCGGCTCGG
GAGAGCACCCGGAGTCTCCACAAAGTCGCTGGAGCGGACGGCCATTATACCTTTGCACAACAGACCAGTGAAGCTGGCCAAGCCGGCGTACGATGTGGAG
AACCATCGGCAGTTCGAGCACTCTGTCCGGCGCCATGTGCGGTCAATTGCTTCACTGCAACAGGAAAAGTGGGTATACATATGGTATAATCGCGAATTGC
TTGTGTGGTGTTGACGATTAATTGGATTGCTGCTGCTACTGTTAGGGGTCGAATCGCAGAGGAGGCCACGAAGCGACAGGCATACCTGGCTAGGAAGGCA
GAGCACGGAGCGCTACTGGAGACCACCAAAGCGGAGCGATTGCATCGCGCCTTTATCCATAGTAGCTACATTAAAGAAGCACTCGAAGAGACGGACTCGC
CGGCCTGGAGGCTGGCGCTGCAAAAGAAGAATGCGTGGGAGCAGCGGCGGGCGGCTTTCTTTCAGCAGCTGATGCAAAAGCGCGAAGAAGCGGAGGTACG
TCACGTACTGGAGAAAATTATGTTGCTACCGTGTACGGTATGCTGACAATGTGTTGCATTGCTGTTCGTATGATTCCAGGAACACCTTACATTCAGTCTC
CGTCGAAAAGTGAAATGTGATCTGGATGACTTTGATGTACGTGATGTAGGCGCGTGTACTCAATATGCTTTATCATGCTGCTGGATTGACAAAACCTGGT
GTCTCTAATAGGGTCGAGGTGGATCAAAGCCCGTGGCGACGGGCGGTAAGGTTTCTTCTCGCAAATCAGTTGGCTATGGTCTCCGCTCACTCACAACAGC
GCTCGGAGCAGCTTCTGACAAGAAGAAGTACTCGACCTCAAATTTGGCGGGATCCTCCATGAACGAAAGGGAGCTTTACCGAGCTAATGTTATGGAAATG
GAAAATGCTTCGGGCGTCATAAAGCAACAAAGGCATCAACGTGATAAGCGCAAGGAGAATTTTTCTCGCAGACGGAAGCGATTCGTTCAAGAATGCGTTT
ACACTCACTCTCGGATAGGAACAGCGCGAGTAGCAAGCGTTCTGGAGGATGCTGTGGTGCGCGAGACAAACAGTGAGAAAGACATACAGGATGAGATGAG
CCGCATTCTTGTCTACAAAGAGGTGGCTCGCGAAAACAGGGCAATGCGAAGCCAAGAGTATGTGAACCAGCAAGAATTGGACTCCGTTGCGGCGATCGAC
CGGGATACAAGCTGCTATCACAACTTTCTTCTTGAATTTGAAGATGACAGTGAGATGCAGATGATCCAGCGAAACAACGCGCAAGTGTCCGTTGAATCCG
CTGACCGTTTTCTCAGCGAGCAAATTTCAGCTGCAATTATGAAAGACATGGTGGAATTTGTTCTGTTCATTGCGGGGAGGAGAGAAGAAACCTTGCACTC
TAGAGACCCAGCAGTGTTCCTCACCTCAGAAACGTGGAATGAGTACAAGGTTCAGTTTTCACATAGCTGCAATCTCGCGAACGTGCCCTCGTTGCCGGCC
TCTGAAGGATCAGGCCACGCTGACTTATTGGCTAGCCACGAGCTGGAGCAATATTTATCAAGCTTTCGACCATTTCACACAAGTTCGGATCCAGATGTCT
TTTCAGCGATACCCGGCGGAGAATTATTTCTTGGAGCCACAGATTTAATTCAAGACTGTTTCGTGCTTGGAGAAGAAGTAAAGTCTTTGCGGTGGATTGC
TCGTTCAGCAACACAGGGAAATGTCTTCTTAGACGAAGGAGATCTTGGAAATGCGGATAGTGACCCAAGTCCTGCCCTTGATACAACCAATGTCCATCAA
CAGCTACGCATTCTCATTTTTGGCCCTCCATTTGCAGGAAAGGAAACCCAAGCAAAGCTTCTTGGTGAGACACACAACCTCGTGGTCCTCTCAGTTCACC
AGTTGGTACAACAGACCGTCCAAAAGTCAAGTGAGATTGGCCAGCAAGTGGAAGCTCTCCTAGCAAATGGGAAAGAAGTTCCTCCAGAGCTGTACAGTCG
TCTTGTGATCGAATCGATCCGTGAGATCGAGGCTCAAGTGCTTGCACCAGAAAATAAGAGGTGTGGATGGGTAATTTATGATCTGCCTGCAACAGAGAAA
CATGCTCGCTGCTTGGAGGAACAACTAACTGGATACGTGGACCCAGCGTTGAAACCTTCCCCGTACGATTTTGAATCTGCCATCGCCCCTGGTCGCAGTA
AGCCAGCCTTGCCACCAACCTTCCTTCACGGTAAATCTGGTGTGGACCTGGTATTTCATATCGATTGTCCTGCTGGCACTGTTCTCGACCGATGCTTGGG
TAGGGTCGAAGACCGTGCAACAGGAAACAAACATCACTTGGTATTTGATCCCCCACCTGATGATTCAATTGTACGGCATCGTCTGCAGCATGTTAACCCA
AGCGCATTCTCAGGCGAGCTTCTCTCACTGCACTACTTGGCCAATGATGAATTCTCGCATAGGCATAAGGCTTGGCACGCCACGTTTCACACGTTGTACG
AACCTGCTAGCACCGGAATGAGTGCAAGTGAGGTTCAGGAAGCTATTAAAACGATCGTAGACGAACGCCAGAAGGAGAAACAAGAAGAGGCGGAGTCAAA
GCAACAACAGCAAGAAGCTAGTGAACAAACACTCATGGTAAGTGAAGAGGAGAGGCACAGACACATCGACACCTTTGAAGTGGAAATCGATGAGGCAAAA
CAAGTTGTAGTCAATGCTGAGGTTTCTGTGGCGGAAGCCGAAGAAGCGAAAGCGAAGAAGGAGGAGATTTTGGAGCTGCGGCAGAAGCTGGAAGAGGCCC
AGCGTCTACTAGACGGGGTAATGACCGATGCAAAAGGCTGGGTGGTAGAAGAACAATCACGTCGCCCTCTGCCTAGCAGCAACTATTCGGGTGAGCTGGT
ACCAGCAACGGCTCATGCACTGGCAGCCATGTGGAATGACATGGAGGTAGAGTACATTTCTACGATGAAGACAAGTTTTGCACTGCTACGTGAGCAACGC
CACCGTACGACCGAGCGCGCACGACTAATGACGAGTGAATTCTGCGAGTTTATTCGGCGCCCTGACCAGAAGCAAGAGATTGTAAACCTGTTCCAAAAGC
TATTCAACGAGGTGGTTGACGAGATGCGTTTTGACGACCTTACAAAGCTAGAACTACATGCTCGCGCAGATGTGCTGCAGGATGAGCTTGGTGCTCTCGT
TGAAGCCAACAGTGCAGATAACGATGAGGAGCTCAATAGCATGGTTGGTGACGGGTGGACAGAAGATACATGCCGACGAGTAGCTGCTATTTATCAAATG
GCACTTCAGGCCGAATGTGATCGCTTTCGAATCTCCGTTCAACTTCTTGTCGATGCCCACCACACTGCAAGTGGCGATCGCTCTGAGATGAGCAACATAG
TGGAAGCCTGGCAAGTGCATCAGTCTCGCTTAGAGTTGGCTTGCAGCATTTATCGTGATCCTTCAAACGATACTCCACCAGAAGCTCCATCTGCCCCTGT
AGCAACAGGGAAAGCTACCCAGAAAGGAAAAGCGAAGGCGTCCGTGCCCGCTGTAGTTCCCCAAGCCAGCACGGCTACTTCTAATGATGATGCTCTGACC
GAGTCGCTGACCATGAACGAGCTGCTAGCCGAGTATGGTCATGTTCTCCAACGGTGCGGTTCGTGGATGGATGCAATCGCTCCATTTGCAATCGCTGCGG
CTGAAAGCAGTGCCGGCAATAGTCATGCGGGTGACTTCTGCAAAATCAACCTGTTGCGCGGGATCAAGTATGAGCACGACCTCATGCAGCGGCGGGTACG
GTTCCTTCAAGAATCAACAGAGAAGTCGTGTGATGAAATCACGCGGTCGATGCGTTCCGTTGAGATCACTTTGCGCGATGTTCTTGAGGATCGAAAAGGT
CGAGAGCAAGTGGCGATAGCTGCCTTGGTCGAACACATCCGCGTCTCCATTGAGGCTGAAGTTGCTCTGCCATCCTTCATTGATATCAGCGTAGGTGCCT
CTTTGGTCTTCATTCTTGACGCGGTCTAACCATTTCGTTTGATTGCAGCCTGAATTCACCCAACGCTTTCCAACAACCATGCAGTTGTGTGAAGATACCA
TGGTGCGCGTTGACGGTGCCAGGCGCTTGCTACCACGAACCTCGCCCGATGCGCCGCCTATTGTTGAAGAAACGCACGTCCTGCTTCTCAATCCTCGTCA
ATGCGCTTTGCTCCGGGAGGCATTTGCATCTCAGACTACCGATGACTCAGGACTTCTTCCTCTGTGCACTTTGGTCGAGACAATGGCAGCTTTAACCTCT
CTCTCTGACGCGCTTCCTGATGTCTGGCGTCGATGCCCCGCTCATGTCATCGCAGAGGTAAAGTCACCATTAATTTCATATGATTCAAGCGGTAGGCTAA
CCCGTAAACTCTGCTCTCTGACAGATCGCTGCAGGATTCACAATGAAGCAATCGGCGTTTGTCGACATCGAGGCTCTGCTCACTGCCATGAGCACGCGAG
ACGATCTCCTCCGTCAATTCCAAGAAGCCGAAGCTCTCGAGGTACAGCATCAACAAGAAGAGCAAGAGCACCAACTCTTTCTACAGCAACAGCAAGTGAT
CAACGCAGTAGAATAACTGCAACAAAGCAAGCAAAGAGGCCGTTGCAACTAAGCAACAGCCGTGCATTGACCCCCGTCGTCTCCTGACCTCCCTGTGCTT
CCTCCTTCTCTCTATATCGTCTGCCTGTCTACAGGATGACTGGGTTCTCCCCCACCTCCTCCACAAAGTCGTGCTCGTCGCCCATGAAGATCTTGAGCTT
CTTGTCCTGCAGTGCGCGCATGCGGTTCTTGGGCAGCATCCCGAACACGGCCTTGCGCAGCACGTCCTCGGGCTTGCGCTCGAACAGCTCCTTGGCCGTG
CGCTGCTTGAGGCCGCCCGGGTGACCCGTGTGCCAGCGATATAACTTATTGTTCCACTTGTTGCCCGTGAGCACGATGTCCTTGGCGTTGATGACCACGA
CGAAGTCGCCGCAGTCCACGTTGGGCGCGTACGTGGGCTTGTGCTTGCCGCGCAGAATGGGTGCCAGCTGCGACGCCAGGCGCCCGAGCACCTGCCCCTT
GGCGTCCACCACGTGCCACGCCACCTTGGACGCCTGCGCGATCTTGCTCATGCTTCCCTGCAGCAATAGACTTCCCACTAACGCGTGCTTGCTGCTGGCC
GCAGAATGCCGATTCACTCGCTGCCACCCGCTCCAAAATTATATTGTCAAATCAAGGTACAATAAAACTGTTATCCTATAGCATTTCACCCAATATTTGA
CAATAGAGTTTTTGCGGATCGACGAATTTTGTTTGGATCCTACACTATCCAACAATCGACGGGATTATAGCGATGGGCCGCTACACGACGTTCAGCGACC
AGGACGCCAATGGCGCCGCCTTGCGGGACGAGTTGCCCGCACCTGCAGCCCCGGTACCTTCTCCTGCCAGCGACGCCAAAGACCACAAAGACCCGGGCAG
GCTGCAGATCAACCGCGTGGAGAACGTGGCCGGCAGCACCGCAGGCGCCGGCAGCGGCGAGTTCCACACATACCGCGCCTCTAGAAGACGGTAAAAAGAC
GTAGACACTGTTGTATATTTATTTGCTAGTTCCTGACGCTACGGGTGTTTTCATGACAGTGAGATGGAGCGTGTGGCACTCATGGAGCAGCGGTACAAGG
ACAGCAAGGCGCAGCAAGAGTTCGAGACCAAACGCAAGCGCAACGCCGACGAGTTCGAGGCCAATATGCACAAGCGCGCAGAGAAGCGGCGACGACGCAA
GGAGCGAGCCAAGGCCAAGGCGATGGATGCGGAGCAGAAGGAGGAGACGAGTGCACACAAAAAGGAGCAGGTGCCCGAGACGCCCGGCGGCGTGCCGGAG
ATCCCGAACGACGGCAGCTTCTTGGCACGGATGCTGGCCCTACAGAAGGAGAAATGAACTTGAGCTTATGGGTGGTGAGGCCATGTTTGAAAGAGCTGTT
TTTCTTTCATTTTGTTACATGCAGGTTGTTCCTCTTCTGGTTGCTAACAATTGTCGGCACGTACATACAAGAATGAATTGACAGCAGGCTGGCTAGTTGT
CGTCCTGGAAGATGAGCGCGACACCACGTAAGACCCACTTGGAGCTGCCGCAGTCGGTCGGCAGTGTCGCCAAGAAGATGTACGTGTGGCCGCGGAAACG
GGTGAGGTAGACTGGACACTCGTACACGTTCGGGTCGTGGCGCAGGTAGCCGACGGAGGAAGGCTCCCAGGTTGGTAACGTGGTCACAGCCTTCACGTAG
ATGACAGGCATACTCCAGAGCAGCTCCTTGGGATTGCTGTCCAGCAGTGTACCACCGCACTCGGTTGGAGGAGTCGCGCCAACTGGGTAGCGTTCATTGA
TCTCGTCTAGCGTGCTCCACCGCGCACCCTCGAGAATCAGTCCGTGCGCGAACACACCATCGTCCGGGTAGTACGAGACGGTTGAAGGGTCTTGGATCGT
TGTGACGTGGGTTTCCACCGTCATCTGGTTAAGCGGCATGAACCGCTTGCGAGAGGTGACCTGCAGACATGCGGTCGTGTAGGCTGTGGGGTTGAAGAGA
CCCGGCAACCAGATAGAGAACGGCGTAACGAAGCAGCTTCCACCTCCCCCTGAGGTGTCGCCTGCCCACATGAGAAGCTGCTCGTGGCGCTTCACCATAT
CCGTGAACCAGCCGCTCAGCGACTTAGTAGACGGCCAAGCCTTCTTCTCCCACTTACACTGCGAGAACGGGTTCCGTCCAGGCACTTCGTTTAGGGCCAT
GGCTGTAGCCAAGTCCTCCATGGCCTGGGACATATTGAGTTGTCCATTGAGACCCTTCTTCAGGTCACCAAGCGATAAGCGGATCTCCTGCAATAGCACA
TTCATACGACTGCACTCCTGCAGAGCCACCACGACGAATGGCCCGTGCTCCTCGATCAGGTGAGGCGTTGCAGCCTCCACGACGTCTATCATGCTAAAGA
ACTCAGGGCAGCGCGTTTCCAAGTCATCGATGGTTGCACGCAGTGCTGCCGTCTTGTCACCGCCACCGCCCTCCTCTCCACCACCGCCACCGCCAGCACC
GCCGCCAATGGTCACAATTGTGTAGCATAGTGTCTCGCATGTCGTGGTCAGGTAGCCGATTTCAGCGTTCGGGTGAAGCCCAAAAAGTGGTGGAGCTTCA
GGAACCATGTTCTTCTCGATGTAGTTGGCATAGTCTGCGAAGGAAAACTCCTGAGGATTCGGCGACTTGAAACCCGGACCGAGCTCCATGCCGCTCATAA
GTCCTGGATCGATGAGCACTTTCAGGTACGTGTTGTTTGTACGACGGTCCCAGGCATCCGTGATGTGGCCACCGTACATGATTTCACCAAAGAGATAGCG
CAAATCGTCCCATGGAACGGATACATTGTTGTCCAGGTACGAGTGAAGAATATTGGCGCAAATGGTGAGGTCTCCCGTGTTGAAGCTGTACGCTCGACTC
CATCCTTGTTGACCAAATCGCCGCCTTCCTAGCACGATAGCGTGGAACCAGCACAGAGAGAAAAGACAAGCCTTGAATTCCGATGGTTTAGTGCAGGCCT
GCACCTTGTCCTCACCAAAGTTGGCCCAAGCACGTCGTAGGTTCGACTGGATATCTGAGGGAGCCTCGTTGGCGACTTTAATACAGCTTTGGAGTAGCGA
CTCAGGAATGTTCAGCATGTCAGGCAGCGGGGGCGGTTCAGCTGAGATAAAGCATCGGAAGAGTTCATGTGCACCTTCAGTAGCCACCTCCTCCAACTGC
CGCTCCAGTGTCGGCAACCATGACTGCATCAAGTGCACGTTTTGCAAAATAATCCAGCCACCCTCAGTACTTAATCGCTTCAATGCGTCTCCGGCGTACG
CTTCTTGACCTTGGCCCATGGAGATATTGATGAAATTGTTGTTCTCTAGACTCACGCCATTAGCTTTACCGAGCGTTTCGACCCATGGCGTTGGATCTAC
ACCGGGGAACAGTACAAAGAAGATCGGAATACTTGAGTTCGTCTCTGCGTAAGTAGACTCCATATTAAACGGTGGTTGAGTGACATACTCCTCGCCCAAC
GAGTCAAGGATAAATGTACGCAGAGCATTGGTGACACGATCGGGTCGCATGGCGCGCAGCAATATCAATCGCTGGAAAGCTGTAAGCTTTATGAAGTCCC
CCGGGATCTTCTGTCGCTCGGCATCCTCGGTTGCAAACCACTTTCTCCACTCGTCCGGGTCATTTTGGATCGCGTCTCCTAGGCCTTGGAAGACCTTGGC
GCTCTCTAGTGCTTTCAATTTGGCCCAGATTGCTGCAGGGAGCCACTCTGAGGCTGATCCAGCATTTCCTGCGTCCGGGTGGGCTTTGCTAATGAGGAAA
TACTCGACTTCGGAATCGCTCAACAACCCGTCCTTCAGCAAAATCTTCAGACACAACATTGTCGCTACCGTGAGCTTGTTGCGCTCGAAGAGTCCGCGAC
GAACGTAGTTGTACACGCACGAGGTGATACTGTCCATTAGCACTTGGCATCGCTCCTTCATCTCTTCATCTGTCAGATCTGCGACGGCGGATTCGGTCTC
CTCAGCATCTTCATCACCCCCTCCGTCGTCTCCACCTTCCGTTGAGGCTGCTGCCCCAGCATCAGCTGCAGGTGCAGCTTCACCTTCTCCTGCACCATCA
GCAATGAGATTATTCGCTGCTGGCGCGCGGTAGATACCAGACAAGAAAACCTGCTGGAAGGATGCCAGCGAGTAGATGTAGTAGCAGTGCACCTTGCTGA
TGTCGTTCATCAGGAAGAACAGTAACGAGCCTCGCGCGGCGATGCTGCGGTACTTTTCACTCGTAATGTTCACGGACTCTTGCGTCTTCTTAGCAGCCTC
CATATTGTTCTGGGTACGTTGGGCTTTGTGTTTTGTGTCGCTCAGAATCTGGATAAGCGGCTGGTTGTTCGTGATATCATCGTCTGCACTTGCCAAGTAG
AACAGGATATCATCCTCTAGCTTCTTGAGCTCGATCTTGCCGTTATTCTGTTCCTGGATCAACTTCTCGCGTTTAATGGCCAGATCTTGGCGTTCCTTGG
ACACAACAAGGTTCAGCAACTGGTCTTCAAGGCCAAGCATCGTGACAGTAAAGTTAACAATGGTGCATTCTGCTTGAATCTCAGGCGGGTAGTGCGGATT
GCCCAGCTTTGTGTGCAGGTACAAGTGGAAGTTGTCGTTGTACGGGACGGAAGCATCACCGATTTGGATCTCGTACCGGGCGCCACGACGTGAAGTTGAG
CGCTGAATGACAGGAGCCAAGATGGGGTCAATCTTCTCGCCCAAGTTCTCGATGAGGAAGGCACCATCCGTGCCAATTGCCGTTTTGAGACGCTCAATCC
ACATTTTCTGACCAACTCGCACAATGATAAGGTTGTTGTGCGCTTCCATTTCACGAATCCATGCAATAGCTTGCAACTGCGGGTCGACGATAAGTGGTCT
TCGTCCCATAGACACTGTGGTCACCACAATAGCACCATTTTCCGTTGACACTCGATCTGACGGAAGCTTCTGAGTGTTCCACTCGGCGATCTGCGCATCG
TTTGTCAGAATGAGTAGTGGGTTGGCTTCTTCCGACATAGCAATGCTTTCACCTCCGGCTGCAGTGCGCAGGTAAGGCACCCAATGCTTGTTAATGAGTT
CATCTCGGAAGGGCTTCGTGAACGGGCCAATGTATGAGATGAAAGCAGATGCAAGCAGCACATCGCCCACCAGTAGATCCTTCTCCTTTTGAAGTTGCAG
CACATTGATCCCCCAACGTACGTTTTCACTTGAAAGATCATTAGTCAGGGTGCCTGCGAGCTTCATCTTGCGATTTCCGGTCTCAACAGCATTAATTGCG
TCTTCTTTCTCCTTCTCGGCTGCAGCTGCCTCGGCCAGCAGCTTGTCTAGCTTTGCCTGCAGATCAGCCACAAGCTCGGTCACTTCGGTTAGACGAGCAT
TTGCAGCCTCAAGCTCAAGGTTGGCAGCGGCCAAAGCTTGTCGCTTCGGCTCGACCGTGATGACGATATCGTAGTACATGACGATGTTGATGACCCATGA
ACACAAACCGGCAGCAGCCTTGTTCTTTGTGAGAATCGTATCGTAGTTGAAGTGTTCCATCTCTAAGAACACGCGCACCTCTTTCCAGTTCGTGAGAGGT
ACCTTGCCGTCGTCTACGACCTGCTTGAAGCCCACCAAATAGTCAATGTACTCAGGGATGTTACCCAGAAGCTGCTTCTTGGCGGTGTCCCATTTGACAT
CCTTCACCTTACCAGTCTTGGTAACTTGAACGTTCGGGTGGACACCAGCCAGCAGAACCATGGTAGCTGAAAAGACATCGTCTACACCAGCAGGAGGCTT
CGACATTGTTTTACACTCGCCCAAATCCTTCTTGTTCAACGAGTCAAGTGCTGCCATAGCCTGTTCTACAGCAGGTTCAGCTTTTGCAAGATCCTCCTGC
GTTGAACGTTGTTTCTCTGTAACCTCAGTTTGGATAACGGCACACTTTGCAGCTTCGTCACCAGCCTTTTTACTTTCAGTTTCCACATTGGCCTTCTCTT
TGTTCACAGCCTCAGCAATACCAGACGCTACAGCTTTCTTGTCTTCAGCAGCCTCAAGGATAACCTTAAGCTCCACCTCAAGTCTCGACACGGTATCACC
AGTTTCTTTAAGCTTTTGAAGTCCTTTCTCCAATCGATCGATGGCTGCAGCGTACTCCTCCACTTTCTTGCGCAAAATCTTTTTGTACAGCTGAAGCAAC
TCCAGGTACGACTTGGGTGTTGTGTACACGTGGCGGCGCTCCACCTGGAAGAACCGCTCGGCGCAGAGATTCACCGACTGAAATGAGAACGGCATAAATG
TTTCAATACCCGCGCGCGACTCATCTGACCCAAGCAGATCTCCAATCTCCTTCAGTTTCTCGCGACCGACAGAAAGTAAAGCTTCCTTAGGCCATGGCTG
GAACCAATCAATGACTGTGCAATTCACCAGTGCGGGGAACTTACGTGCACGGTTTCGGAAATCATCACCCACAGGCGAAAAACATAGGCACAAGTGGAGT
CGCTTACGGATTTCTGCTTGGAAGAACTTGACAACTTCCTTGCGGTCCTTCGTACCAGCTACAGGAGACAGCAAGTTGACGATATTGTCCATATCCTCCA
TCGCGAACAGATCTGGAATTTCTCCCGACGCCAGCAGATCGTTCAAGTAGATGAGGAACTTTTCGTTCGTAATTTGAGAATCAGTGAGCATGAATACGAC
ACCTCCATCTTCTTCATTACGAGACAGCATTTCCACTACCGCCATGTGCATTTTGCGCAAATCTTCCTTGAATTCATTTTCGCCGTACTTTGAACTGATC
GTGATCTGACGAACAGTACAGCCGCAGATATGCGAGGCTAAGCGTGCGAGCGAGCGCTTGCCACTACCTCCCACACCTACCAGTAGTGCATGCCCGCTTT
CGTTTCGTAAGATACGAACAATGCGAGCCACGTGCTTCACAGCATCATCGAACAGGTCCAGCTGCATAGCCGTATTGTTCTCGTTGTTGTTGTATTCGCG
CAGCTGGATTTGCAGGTTCATCTTGAGATCGTCCAGGTTCGTCCCCATAATTTGGTCGTACTCGCTATCGCCATCTTTAGTGAAGTGGCAAAAGATGAGG
GGCCATGAGTTCTCGGCAGCGTAGTATCGGCTTGTGTTGCACGACGCGAATGACTTTTTCACTTGCATCTGTACGAGCTGGTTGTATTTTTCGATGTCGG
CTTTGCATACAAGTCGGTCGCCGTATACGCGTTCACTTTCGTGCAGCCACAGCAAAACGAACTTCTCCTGGCTGTTAAAACGATCCTTTTTTGATGCGAT
AAGCCCTTGGAATACATTGGACAAGTGGCGCACATTGAACTCGTAGTGAAAATTGGCTGCTGTTTTGCGGAACGTGCTCACAACGCTGGCATGCAAACTC
AATGCAGCCTTGATAAGCGCGTTAGAGAACTGGGAGTTACTCAGCTCATCAACGAAGCCTGATAGATGCCCACCCAGGAACGTTTCATAGATCGTCACCA
GACTTGGTGCTTCAGGCATACCCATAGCAAATGTACAGAAGTGGCGCTGGAGTCGAGGGTCAACCAGGAATGAACCTGCTGTAGGGTTCATGCCGGAGAC
CATTTGCGTATTCAGAATATTTTGCGTCTGAAGTTTTACGCGGTCGAACCAATGTCTGTACTCCATCACTTGTCGCAGCAGAGAAATAGCACTTTGTGTG
TTATATGGGTCTACCTCTGGCAGATTAAGATCATCCATGAAGTAGATGAGTCGTGCTTTGCCGGGTGGACCAAGATTGATACCGGTTTTACGCTCCAGTT
GTCCAAACATGGTTTGCTGCAAGATGGAACTCGTGGTGTAGAAGTTGAAATTGATCGTACAGTAGCGGAACGCAGCCGTTGCCTCGTCCTTGCTGAGCTT
TTTTAGCATGCCCATGATATTCTGCGTCTTGCCCGTACCTGCAGGCCCGCACACCATAACCGGCACGCTCTTTGAGATAAGGTTCTCGAGCCAAAATGCA
ATGGATGCAGTTTCGGTGGTGGGTACTGTGATTTGGTTGATTGGGCTTGGGGATACATACGTCTCCGTGTAGAAGTACGGACTCTTGGACCACGAATTAA
ACTTCGAAGTCTCCGGGTCAAGCCAGAAATCAAATACCGTGTTGCTGGCCGATGCCACCAACTTAACGTCCTTCCATTGGTTTTTCCACCAGTTGCTAAA
CTCGACTGAGTAGTCCGTGCCATCGTCACTCATGGTGAGGATGGATCCAAACGACCACACACAGCAGAACACGAACGTGTTTTGCATCACTGTGTAATCT
TCCAACACTTGGGGTGTCAGCAGACAATCGATCATGTTCAATAAGTTCGTCACGAGCGTCGTTTCTTCTACAGGGACCACGGGGACGAGTTTCTTTCGGA
AGAACCGAAGGGTCGTTTCGATGTATTGATCAAAAAGCGCTTGGAATTTGGAGCGCGTGTCTGGGGTGAACATCATATTTCTGAGGCGGTGATCCACAGG
CTGCTGACAGTGTCGATCAAGCCAACTGTCAATCAGGCAGCGCCACTGGTAGCCCTCTGATGTTGAAATGTAGAGAATGCCGGCACGAGATACGGTAGCC
GGCGTAGCGTAGACTAGATCACGGATCTCGAAGATCATACGCATGTGAACTTTCAGTGGAATACGCTCGTTCGAGGCCAACGTAAGCATTCTGTTATCGT
CCATGACTGAGTTCATCGACTCAATCCAGTTAGCATCAAGATCTCCGTCAAGAATAATCCACTTGGGGTTGTTGTCTTCATCACCATTATCACGGCGACG
AGAGCCCAGATCTCGCATAATTCGAGACAGCAAGCCATCTTTCCATTCGCGTGTCTTCAGCACGATATACCCGTAAAGCTCGTTCGTGCTCACCGATTTT
GGGTTTAGGTCTTGGACTTCCATAGGAGTGCCCATGATCTCGCGAGCCTTCTTCAGCGTCTTCCAAGTCTCTGTTTTACCTGAAGCTGGTGGCCCCATCA
CGAAGACACAATGCCGAATCGCCAACAATTCTGACAGCTGCACAACCTTCAGCATAAACTCTGGGCGAGGTGTATTACCGATTGCTTCTGAAGCGCCCTG
TACCATGGATTCAAGCTCCATATCACGCTTACGCGGAGGGTCGTTCCGAACGTCCACATTCGGACTATCACGCGGGAACAGATCTCCGAGAAGACCGAAG
AAAACAACCATATCCTCAGCAACGATTTTAGGGATGTTGAAGTCTCGCAGCGCGCGCATGAGCAGGTCCGTTTCAGGAATGTCTGGTTCTGCACGTTTAA
ATGCGCCGGCAACGCATAGCACACTCTTCACAGCTCGAAGGCCCCAATCGTAGTGCAGCTGCTTGGACAAAAGTTGCCCTAGCAATGAATACAAACCGTA
AAACTTTGATGCCAAGATCTTGGCCTGGGTGAACCCTTCTGCCATAAGCATGTTTTCACAGATCAACACCAGATCGGGCACCATGACAGTCATCGGGCGG
AACAACGCTTTCAGACCTTCGGGCAGCTCAGAGCGTCCTAAGTAGCCTGGATTCATAGTAATGAATGCACCAACTGTTGGATCAAGCATCACCTCGTCAT
TCTCAAGGATAAATCTCTCGTCGTCAGCTTTACACGCGTCGCATACAGCCTTAAATTGGACAGAGCACACCGACAACACTTCTGGCACGAGACGATTGAA
CTCGTCGAAGCAGCCCCACGAACCCGACGATGCAAGACCTTTGAAAATGTTTCCCAAACTCTTAAAGTCCATTTCGGGGGAACAATTGAACACATAACAC
ACTTTCCCCAGTGCGTTAGCCAAATCTTTTGTCGTCTCCGTCTTACCCGTACCAGCTGGACCAGCAGGGGCACATCCCATTTGCAGGTTCAGTGCTTGTG
TTGCCGTCACGTAAATTCTATCGGTCAGTGGGGTAATCACCAGTCGGGGACCATTTCCAAGATATTCGTAGTCGTACGGAATACCGGCATCACAAATTAA
AATCTGAGCTCGAGCATTGTTTGCTCCACGGAATGTACTATCACGTTTCAAGAAGCTCCCCGCTGCTGGTGAAAAGTAGTGTTTTAGCTGGGACTGCCAC
TGGAAGTGAGTTGCCTCCTCCACTCCGGCACGAATCATGTTTGCTACAATATCTCGGCCGTGGGCGTCCATCGTAATAAGTACCATCACTCGCTGTCGCT
CTGCATACGAAATATTACTTTGCGTGAGCTTAATCAGGTCTTCTAGCTGTTGCTCCTGCATCTTGTTGTAGTTTTTCAAGGCATCCTTCTCGCCACCTTG
AATGCTACGGAAGGCACGCTCCACTTCTTGAACGTAATGCACTCCTGCTGCCAGTAGAATGATCTGGGCTGCATCCATCGGCTTGTTTGTGTCATCCTTA
AAGTTGATCCAGTCTACACGAGGCATTTCCGTGTAAGCTACAAGCGATCGATCAATATGCTTGAACAACGTCAGTCTCATAGCACGCATGATAGTCTCCA
GATAAATTTCTGCTTCTCCCTCAAGCACTGGGGCCTCAAAGAAGTCAACAATTTCGTGGCCAACACCAGCCACGAAAGATGTTGCGACCGGCCGCTCTCC
CGCGCCACGATCTACCAAAGTGAGCGTCTTGGTCGCCAAGTAGATTTTGGAGCAGTGCGGCATAATCCGGTCGGGGTGAGATCCATTCGACAGGATATCC
AGCAAGTCTGCTTCGGACATAAAGTAAAATCGTGGGAACTGGCGGCGGCGCCCGTCCAGGAACTCTTTCAGGCGGTGCTTGCATAGCTCTAGTTTTTCCA
CGATAAGCTCCAATCGTTTGATGAGGCCTGGGTCGGTACACGCTTCCTGCACATTTAGCGTTTTCCACGCTGTCTTCAGAATTTGTCGGACCTCTCGATC
AATATCTTCAAAGTCAGAGGTCAACTCCGGTAGCTGTTTTTTCACTTCTTCAGACTGAATAAACAACGGTTCCAAGTAGCTCCACGACCTCTGGATGTCA
CCCAGCAGTAGCACCACTTCGTTGATGGATGAAAGTCCGATCTGAAGCTTCGCGACGCGAGGCTCAAACTCAGATTGATACGGTGACGCGCTCATGCCTT
GTACATCGATTTGATGCGTCTCCAGGAGTTCAAAGTTCTCTTCAGACACCTTGAGGAGAGGAACAATGTCATCTTCGGCAGCACCGGGGTTGTATGGAGA
CATCTCCCAATTGACCTCTGCCCACAGTGCCTCGAGCTCAATAAGCCTAAGCTCGAGTTCCTGTTCCTTCTCAGCTTCATAGCAAATCTCATTAATGTCC
GAACTGAAGTTGAACAGATTCTTACTCAAAATCAGGGATAGCCGCTGTTCTGGGTCTTCGTCCGGTGTAGGGAACTCTCCCGTGTGAGCCATGATACGCT
TCCAGTGTCTAGGTCGCATGTAGCTGGATGACACGCACCGAATAAGTGGATGCGTCTTATCAAATGCTTGGCATTCCTTCAAAATCGAGGTGTACGCATC
GCTCCACTGAATCCCCTTGGGGATCTTTTTGAGCTCTTTCAATGCAGACTGAACTTCAATCTGCAGCGCATTCACGTCCACTTCTTTGAACAATAAGTCC
TGGGTTGCCTGGAAAAAAACTTTTGCACGCTTAATGATTGCCCATACGGTTTTCATTGCATCTGCATCTGCCCGCATCAGACCCATCATGCGAAGCGATT
CATTCATTAGTTGCGGAAACCCGAAAGTCGAACACAATTTAGTGTTTTCTTCGCACTTCTTCATCTCCACGTTCCAGTCGACAAGATAACTCTCAATTTT
CTCAAGACCCTTGTCAGGCTCCAACTTTGATGACCAGAAATCGAGCGTCTTGAGAGTCTCCACCTTTTGTGCGATCATCTTCTCGTACGCGATAATCTTC
TCCTCTGTCTTTTCGCTGAAAATCCGCGTGGGTTCCTGGGTGCGCTTCTCGGTCATTGGGATCTGCTTCTCGACGTCCACAAAAAGTTTCTCCATATTCT
CGATTTCTACGAGCTCCTTGTCGACATGCCCCCCACTCTTCTTGATATTGAAGAATAGCTGCCGCACTTGGTCCAGAATCAAGTGATTCGTTGCCTTTTC
TGTCTCTAGCTTGCGGATAATTTCTTTCATCTTCCGCAGAGTCTCAAGGCCGTCTGTATCGTTATTCGGGATGTCTTTCCGCAAGTCAACAAGAATGCGC
CGGAATTCTCCGTTGCGCTTGTTCATTGTGGCCATCACACGCCGGATCAGCTCTGGCGAGTCAAAGTCCTTCTGAGTTGCAAGTGGTGGCAAACACTTTG
TTTTATTCTCATCCGATGGCGGCTGGAATACCGCGGTGAACGGTGAGCCGCGAATTGGGCCTGCAACACCACTAAACGTGCCAGTAAAATCCACCGAGAC
CTCGTATTTGCCTGCCTTAGATGGTGTAAATGTCACCACGTAGGTGCCGTCATTTTTGTCAAGGATGGATGCAACCAGCTCCACTTCGGCTTCGGCATCA
TCACAGTTCTTTAGAGCAATGGTGAACTCATCCCCTCCACAATCACGCGGATTATCGTCTTTATCTCTGGTCTGGATGATAAATGTAGTCGGGAGCTCAG
CCAGGCAATTATCACTGAGGGCAGCAATTAAGCATGGACCAAATGCTAGCGACTTTGGGGCTGCTGTGACGGAGTGAAAACGGAAGGATGTGGAGACGTT
TGTGTACATGCCCCCGGACAACGACACTCGAACCTCGGAAGTCAACGGTCCAAATTTCTCGAAGCTGGGAGCTGTAGCTTGAATAACACTAGGACTGAGA
ACGGCTCCCGTGACGTCGACAGAGCCTTTCGCAACTGCGAAGCGCAGTGTAGCGTTTTGGCCAGTGAAGTTGAAGCCAGAAATTTTTATCTTTGCATTTC
CCGTGATCGGACCTTGCCTTGGTTCGATCGACAGGACTGAGTACGGCGGCCCAACGATCTCGCTTGCATTAAGCACGTGTAAGTCATTGTACCAGCGATT
TGCCCATCCTCCAAAGAAGATCAAGTGATTGGTATTTGCATCAAACACCATCGCAGTATCAGCGCGGGCCTTCGGAGGCTCTCCTTTGACAGGCGGGTTT
AGCCATACCATACTGCCAGTATCCAACACAGCAGTGCTGTTCAAATAAGCTCCTTGCGCCGTTCCAGACTCGGCCAGATCTCCACTGTTTCCACCAAATA
AGAACACTTTCCAGTAAGGCACAGCGGCGACACTCACACACGTGTGATTCCAGATTGGAGAATGAAGCGACGTGCTCAGCAAGCTCCATGTCTTGGTTGG
TATGTCTAAAACGAAGATATCTTGAAACTGCTTGAAGCTGTTCCACCCTCCGATGACAAGCAGTTGCTCCTTCACAAGGCACGTTTGATGGCCCGATCGT
GGCTCAGGCTTCTCACCCTCAGTCTGAATCTCTTGCCACTTAAATGAGTGCAAGTTCAACGCGTGAAGGTCGTTGAAGTCGGTACGCCCAAAGCCGTTGC
CGCCATAGCCACCAAATACGTACATCTTTTCATCTACCAAAGTGGCACTGTGTGCACCGCGGCATTGCGGTAGCCCCTCCCAAAAACCTTGAGCATACTT
CTGCTCCCACACCTTCAGCTCGGTGTTAAAGAGCCAGAGGTCATTCATTCGCTTTTCAGCGGCGAAGCCTCCAAAGATGATGATGTTCTTCTCAAATAGG
ATGGCTGAGTGCCTCCATCGCGGCGCTGGCACATCGTCTTCACTCTGTGAGCTTGCTACCTTCGACCACGTGTAACCTGCAGCAAAATCGAGTTACTCTC
TGATTACTAAAGGTTAACCCTGCAGATCATCCTACCGTTTGTGACGTCTAGCCTGTACAGCTCGTTCGTCGGTCCTGGTGGCGATTTATGATCGCAGCCA
CCAAACATATAGACAGAAGTCTCCGTCTCCGAGCCTTTCAAGGTGAACGAGTGCCCAGATCGCTTGACAGGGATTTCTCCATTCTGTTTCGGCGCAATCC
ACGCTAGTTCTGGTTCGCATCCATACCCGATAGGCTGTCAACACCAAGCATCCAACAACATATTCAATAAGACGATTCAATCAGCAGAGGCACAAAACAA
CCAGGCCAGGTGACACACCATTTCGGCTCTGCCCTTTCCCGGGGCTGCCTAGATGACGCTCTGGCGGAATTCCTTCCACTTGGTTCACCTCGACACCGAA
ACCACCTCGGCTTGGAGCTTGTGTGCTTTGCCGTATCCGCCGAGCTAAGTGGAGGCCACAGAGTGAAAACTCCACGCGATCAGTTGCAAGAGGCGCGACG
GGTCAAGGCAAATCCAAGATATCGCAGCCCCTTCAGCTCCAAGTCGTTATTCCTGCAACCAAAACCAAACACAGCGCACTTGCTCCTTGTGTGAACTTGC
TTGTGGTAGACCAGTGTGCTCAAAGCGCATGCTTTATTTCATTGCGGGATGCTCTGCAACCGCGCTTTTCAATCCGCATGCTCTAGACCCGAAGACATTA
CCTGCCACTTGGCTCAAAACCACAGGCCACACATGGCTAAAACGGAGGTCTTGGCACCACGGTTGCTCGACTCACTCAACACCACTCGGCAGCAGTTGAC
CTACCTAGTTGTTGAACTTGAAGAAAATAATGTCGCCGTCCTGGACCTCGTACTTCTTGCCCTGCTGCTTGAGCTTGCCAGCCTTCTTGACCGCCTCCTC
CGTGCCCACTGCACAATTCCAAAACGTAAAGTTAGTAAAGTTCAACAGCACCGCGCAGCACCACAAACAGAAAAGACAAACTTACGCTCTTTCAGATCAG
CGAACGCCTGCACCTCGGCCATGATGAAGCCTTTCTCGAAGTCCGTGTGGATAACTCCAGCCGCCTGGGGTGCCATTCGGCCCTTGCGGATCGTCCAGCC
GCGCACCTCGTCCTTGCCAGCCGTGAAGAAGTGGATCAAACCGAGGGCGTGGTACCCCATGCGGAGCACACGATTCAGGATGGACTTGTGCGTCGGGTTC
TCCTTCTGGTACGTCTCGAGCTCGCCACCAGCCTCGAGGTCCAGCATCTCCAGCTCGAACTCGCAACTGATGGGGAGAACGGGCTCGTTGCCACCACGCT
CCTTGATGTACTCGGCAATCTTGGGCAGGTACTTGTTGCTCTTGCGCAGGTAGTCGCGCTTGCTCACGTTGATGAGGTAGACCACGGGCTTGGCCGTGAG
CAGCTGCATAGTGTTGAGCAGCTCGACTTCCGGGGCGCTCCACGTGCCGAAGGACACGTCCTTGCCGGACTCGAGCCACTCCTGGATCTTGACCAGAGAC
TCGTACTCCACCTTCTTCTCTTTGCCGCCGACGCCGCGCTCCGCGAGCTTCTTGACGCCCTGGGACTCCTTCTTGACGCGCTCAATGTCCTTGAGACGCA
GCTCCTCCTGGATGATCTGCATGTCCCGCACCGGGTCCACGTTGCCCTCCACGTGGGTCACCTCGGTCGAGTCGAAGGCGCGCACCATGTGGTAGATAGC
GTCCACGGCCTGGATGTGCGACAGGAAAGCATTGCCCAGTCCAGCGCCCTCGGCGGCGCCGCGCACAAGGCCGGCAATGTCCGTGATGGACATGACGGGC
GGCACGACACTGGCGGGCTGGTACTTGTCCACGAGCCAGTTGAAGCGCTGGTCCGGCAGCGGCACCACGGCGTCATTGGGGTCGATGGTGCAGAAGGGGA
AGTTCTCGGCGGGGATGTGCAGCTTCGACAGGCAGTTGAAGAAGGTGCTCTTGCCCACGTTGGGGACACCCACAATGCCGATCTTGACGTTGTTACCGGG
GCGGCCCAGGTACGTGCGCGTGGTCTGCGGGTGGAGAGGGAGGACGACAGCATAAGAGTTAGAGAGAGGAGGCGTCCCCACCTGCAGTGACGTTACTGGG
TCTATCTACCTCTTCGGTCTTCTTTCCCTTCGGCGGCATGGTGCGGGTGCTTCGTGTCTCTCTTTGCTATTAGACGAATTAGACGAATGGCGCTCGTGAG
CTTTTGCTGCGGATTTAACCCTTTTCGTCGCGGGCTTTAAATCACTGAGATATTTAGCCCTGGACCTAAACGGAGGGTTATTTGGCAAGGGCTCAGATAA
TGGGTGATGATGGTGTCAAATAAACCATGAAAAGTTTCATTGGGTAGGTAGGCCACAGCGCTCGTAGAGCCCGCCACAATACAGGACGATCTAGTGCCGT
CTCTTGTCTACAGAGCAGCAGCAGTCGCTTGGTTGGTGCCGCCAGCCTTCACCGCCTGTGCCAATCTGTCCGTTTCTGTGAATGCAAGAGCACAATTAGT
TTGACGATAGGATATTAGCATGGGCTTCCGACAAGGCACGTACCAGCTTTCTTCTTAGCCGCTGCGACACCGAGGGCGATGAAGACAACCGCCATGACAC
CCAAGAACACGCCAACGCCCACGAAAATGGTTTGGGGGGCCGTGTCCGAGCTGCTGAGCGTCGCGCACGAGGAAATATCCTTGACGCTGCAGTCGGTGCC
AGTGTAGCACGACAGACAGCTGCACGACTTGGTACCGTTCGACTCCTTGCACTGGCCGTTGCCGCCGCAGTCGGACGTGCTCTCGCAAGTGCCACCACCG
CTCGTAACCTCGTACGTGCCGCAAATGTCCTCCTGGGTCGTTCCGACAGCAGAGCTCAGCTTCACGTCACATGTAGCACCGCTGTCCGTGCAGACCACGC
CTTCACGACTGGAGCAAGTCCATGAGTCTGAGCTAGAGATCTTAATGTGATCTGAAGAGCAGCTGCTTACAACCCAGCCGTACTTCGTTGCCTGCTCGTT
GGTCGACTGCGTCTTGGTTTCAAGGGTAGGAGCCCACGTGCACTTCGTGCTGTCGGTCCATGCTGCATCATCCGTATAGCCTGAGTATTTGGCAAACATG
GCCTTCAGATTCGTGTAATCTGTCGTGGACTTGGAGCTGGGAGTACTCAAAAAGTCCGTGCTGCCACCTAAACATGCAGACACAACATGAGCCCACCGTG
CGCTATAGTATACAAGAATGAACTAGCTGAGCTGTACCAGTGAACATCGGGAACAGCGAGTCAGACGAAAGCTTGGCTTCACCATACGAGTACGCCAGCC
CACCGGACCAAACCGCCGTGAACTCCTTCGTCTTAGAAGGCTCTTGGTACAGATAAGGAATCATTCCCCAGTCGCGAGCCGCTGCCGAAGAAGTCTTGCA
GCCGTATTCGCCGAAGGCGACAACGATGGGAATGCCTTGCGCCATGTCGATGTAACGCTGATACGCCTCCGCGAAGGTTGAGTCCGGGCACCAACGGTAC
TCGTTAATCAGGTAGATATCAATACTCTCCGTCATCATACCCTTCGTCATCTTGTCTCCACAGAGCAGTCCCTGGATTTTGATCACATGGTAGTCGTCCG
CGTTCGAGACCTCATCGTTGCTACTGTCAGCAGCGGCGTAGGCAAGCGGCAGGATACGAATCTTCTTGCCGTTCACCGTCATCCAGTTCTTCAGATCCGC
CACGTAGGCCTTCACACAGGAGCCGGCCGTCAGGTCCGCCTGCATGATTTCGTTGGCCACGACGACACCGAGAGTGTTGTCGTACTGCGCAAAATTCTGG
ATAATCTTCTTGCCGTACTCAAGCAGCAGCGCTGGGTAGCAGGTCTCCGTTTGATCCACCGTCTTAGCGCCATCTCCAGACGAGACCTTGCCGGAGCAGC
TGAGACCCTTGGTGATGGTCGAGTAACGGTACTTGCCGTAGTAGGCGTCGTTATCGGGCGAGGCAGAAACCATCACGTACACGCCGAGCGCGGCCATGTC
GTTCATGAATTCCTTGTACGAGGACGACGGGTTGATGTTGTACAGGCGCAACGTGTTGTACTTGAGCCCCGAGAGGTGCTCCGAGATCGCAGCCTTCGAA
TACTTGTCGTAGTATTCATCGCTCACGGCGTACTCGTACGTCATCTACAGGATCACACACATATTAGACTAGGATTTACTATGCTGAACTGTGCTCTTTG
GTGTTAGTTGGCCGCTTCCTTCCTATCCTCTTTTCGTGCCGTTCGAACGCACCCCTTTGATGAAGAAGCGCTCGCCCGTCTTGGCATTGTACATCTTGTT
GCCGCGCACAACGATGACACCGTCGACGGCCGCGGCTGCCGTCAGGTGCTGCAGCGTGGCGAAGGCCAGCACGGCCAGCAGCAGGAAGCTCCGTCCAGTC
ATGGCGTCCCCCCGGGCAGCGAGCAAATTCAGTTTAGTCGCGGACAGTCTTTCCCTCCGAACAGAGAATTTTCAGATGGTGCACCCATAACAATACAGAG
GGACTGTGGCTATGATACAGAATCTATTTTGAGAGTGTAGACCTACTAGCCCTCTCTCTACCCGTCCTATTCAATGTACAACAAAGTATGTGTCCATAAA
GGTTATCAGTATTGGGAAATTACGTGCGATTTGCCAAGAACGCCGATTGGACGAAAATAAACATCATACTGTTTGCCTGATTCAACCCTATTATAAAGTA
AATTCAGGCTACTGGTGGCGGCAGCAGAAGTCGGCGAGGCGCGTGTAGGCGTCCGCGAGCACCTCGTGCGGCGCCGAATACACGATGCGGAAGTAGTTTG
TCAGTCCGAAGCACTTTCGGCAGCACGATAGTGAAGGCACAGGTTAGCCAAGCCAAGGATCCAGCAACTACAATTAGGATGTTGGGACCGCACCTGTCCG
GGCAACACGAAAACGGACTCTTCGTCCAGCAGCTTTTGCGTTAGGTCAAAGTCGTCCTTGATCTTGGTCAGCACGTCCGTTTGAACTTTCACCTGTAGAC
GACAGAGCATAGGTGCCAGTTAGGATATTGGTGGGCAGTCGGTTGCGGATATTGCGTACCATCGCGTACATCGCGCCCTGCGGGATCACCACTTCCAGGC
CCGGGATCTTCCTTAGGGTGTCGGTCGTGAATTTGGCATTAGCCTCCAGCGTCGAAAAGTACCGCTGTTTAAAGTCCATGAGAGACTGCTCCTCGGCACT
ACCGGGAATGGGGGTCAGCAGATCAGGGATGGTACTCTGTAGACAGCACAGGCAAACGACGTGGACATATTAGCTGTCGTTCAAGCAGCCATGAGATGCG
ACGAATGTCGTTTTGTTACCTGGACCAGCGAGGTTGCACCAAGGATATTTTGCGACAGCTTGAAGTAGGCGGTGCGCACGTCGCTCAGGACGTTGTTGCG
GTCATGCACCATGACCCAACCAACCCTCCAGCCGGGGATAAGGAACTGCTTGGCCAAACCGCCCACGGCCACGACCGGCACCGTCTTCGTCAAAGTTGCG
ATGGGGTAAAATACGTTGCTGCCAAACACCATGTCGCCGTAGATTTCATCCTGCCAATTGGAATGAGTCAGACTCACGAATGCAATAGGAAATATGGAGG
AACGAGCATACCGCGATGATGGGGATCTTGTTCAGCTCCGCAAGAGCAAGAATTTTTTCCAGGTGGGGCTATACGACACGGCAAATGCAGAACGTTAGAG
ATTGAAGCCCTCTACGACACTTGAAAACAAAATCGCGACGGCCACGAAATGGCGCCAATAAACCATCACCACTACCCACCTTCGAGTACACACTGCCGCA
CGGATTGGAAGGGTTGTTCACCAGGATGGCCTTGGTGTTATCATCCACCAGAGTCGAGAGATGCTCAAGATCGACCTCCCAGTTGCTCTCCGGCTGTCCA
AGCATTGATCGCATAATTCGTTAGTCTAGCAAACAGGGAACGTTGTATACTACTACGTAGTAGTTGACAGAGCAGCTCACCTTCAAGTTGTAGAACCGAC
ACTCTATCTTCTGCGCTTCACAGAGAGCCTGGTACAACGGGAATCCTGGCTTCGGGAGAAGGATGTTGTCACCAGGGTTCAGCAAACCTCGCAGAGCAAT
CTCGATAGCCCCCGAGCAACCACTGGCGATAATAATGTCATCCATAGTCAACGGAGCTCTCATATTGCCATAGTGCTGGGCAATTGCTGCGCGAGCTGCC
TCGGAGCCAGCAGAATGAATGTAGCCATTGTGCTGCATCGAACTGATGAAGCAACAAGAGAAACAGTAAGGTCAGCGCCGAGAACGGCTAGACAGAAAGT
CATGCTTTCAACGAACCGGGTGTTTCGTACGATCGCCTGGACGAGCACATCGGGGCAGTGCAGATTGCCGAACACCGTGGGGTCACCTGCCACGGCCGAA
TGTTTCCCGATTAGCTCTGAAAAATAAATACTACCCGCAAAACTACAGGGTCACTCACCTAGCGACAATGGAATGAGGGTCTTGGTCGACGTCGCGGGCT
TCTTGATGTTGTCCACGATTTTCCGAATAGGGTTGGAGCACAGCTTGGAGAAGTCGGACGGCTGGACATTCCACTGGAGCTTGGCTTGACGCTTGACATC
TACCATCGGCACGTCAAAGGCAGGATCGTCGAAGGTGGCACGCTTGGTCATGACGACAGAAGACACTTGAGTTGAGCGGTCAATTAAGAAATGAGAGTCT
GGTTGAGCCATCCCAGTTCAGGCTAATCTTGTTGTTGAGACGGCGTCTCAGAGACGCAAAAGGCAATCTCTGCCCTATCTACCCGCGCTGACGGGCACCG
ACGTCATTTGGACTAATTTCAGCCAATTGCCGCCGCTCAACAAGTTGCTTTTCGCTGGTCGACTGCCCCGAGTTCAACCTAGGGTAACGGCTTCACGTTG
AACAGGTGCTTGAAGCTCAGCCAAATAGCGACTGGTACATTTCGACAGCGCATTCTCGGCGGAACTGCGCTTGCTTGGCCACAAGTTGTTCCTTGACCGC
ATCTTCCTCGCTTTCTAAAGCACCAAACAGCACACCAAGGAGATCCACCTCAAAGTCATCGCTCTCCCAGCAGTCGGCCAAGACCATCACCAAGTCCACG
CTAGCATTCGCAAGCAGTTCCCGCCAGCATGGGGCATGATCCGTTGCCAGGAGTCGCTGAGTTTTTACGAAGGTGGTGGCGTCCAGCGATAGAAAAATCC
TCTCGCGAGTTTCCTGAGAGTTTGCTGCAACAATAGCTGCCACCACTCTTCTTTCGTCTTGGAATGTACTCTGGGTACCTGCTGCCGCTGAAGACCGCAC
GGCTGACAGACGCGACTCGCACTGCTGCTTCACTAGCTCCTCCAGCATAACCCGGCCGTAATACGGCGCCATGCGTGGGTCTTCTACGAGCTGATCTCGC
ACGCCATTCCACCAGTAATTGACGGCAACGGTAAACTCGTCCGAGTCCACCTGGTGCCACCACCCCTCCGGGATCAAAACGGCATCTGCAGAGGACAGTT
AACAACGCCTTAGTTGTTATCAACGGCTGAACAAAAAGGATAGGATGTAAACCGCTCATAAATACAATCAGCAATACCTCCAGCAGCGACTTCAAAGCGC
TGCGCCGACGCCTCCTTGAAGCGTGGGTGTTTTGCGAAGTCGGGCTGAACAATGTTCACTTGGCTGTGATTTGTAGACTTGGTATGCACTGGGTACGGGT
ACATCTTAGCGGTGTCTGACGGAGGATACAGCGTGACAACCTTCTTCCCATACAACACCACTAGGATGTTTTGGTACGCGTCGTAGTGCAGCGTCGTCCG
GCCAGGTTGCACGGTCATCCACAGGTTCACTTGGGTGACAGACTTGCCTTGAAGGCATGCCGGTCTGCAGTAGCAAGCCCACAAACAAGCCCGTCAGAGT
TGCAGGCTCAAGAGATGACAAGAATAACCACCTTACATGCGGAAATGGTTCATTATGGCTGGCAGACTTGCCTTGGTGCACGTAGCATCGGGCTTGGGCA
CTGCAATGGGGCACTGCGCCAAATAAAACTCCAGGCCACCCACCGTCTGCAGCCAATGCGACTGCTTCCTGAACGTCGCTTGGTAGTAGTCCACGAAGTC
GCCAAACTTCAGGTCTACACTTTGTCTGGCCTTCTCATTGCCGGAGTAGCAGTCACTCGATCGCTCTTTGCACGCGATATCCACCACTAATTCATTGCAC
ACGTTGTGTTAGAGCTCCTGGCATTGCAACCAGCACCCAAAGATCGCATTTCTCTCACCAGTATCTCGATGTGCCGCGTAGGATTCCAGCAAGTGAACGG
ACTCTGGAGCGAACCTTGGCAATTGATTTGGTGCCACGCATTGCACTGCGAAGCCAGCGTAGCAGACCGGGTCGCGCGCCATTGTGATGCCAAACATTGT
GTGGTGCACACAGCATGATGTTTTCTCAATTTCATATTGCGACGCTTTCCTGCTGTGCTATGGATAGGATGCTAAGTCGAAGCGCTATTCGGTAGTGGTT
CTGGCGATGGAACGGTCGAGTCACCAGAGGGTTCCCGTGCTCGTTGGATAGGCGTCGCCTTCGGAGCAGACGATGACTTCGAGTGGCGCACGCAGTATCC
GTGGCGCTGGGCCCACTTCTCGCAGCCTTCCTCGGCACAGCGCGAGCCACCACCGTGCGATCGACAGAAGCCCTTGGATATGGCGCCCTTCGTGCAGTCG
GGATACTGGCACCGCACACCTCCGCCGTGGGTCTTGCAGCAGCCACGAGACTGCACGGCACGTTGGCAACCCTCGACGCTGCAAAACTTGATGCCACCGT
GTGCACTGCACTTGTGGCCAAACTGCGCTACGCGCTCGCAGCCTGCCTCCGCGCACAGACGCCGCCCGCCATGCCCCGAGCAGGCGTTGTTAAAGCGCGC
GAACTTGGAGCAACCTTCTATTTCACATCTCCGGCGGCGGTATCGCTTCGGCGCTGGAGCAGAAGCTCCTTCCCCGGGCTTTGCTTCATCGGCAGCAGGG
TCCATTGAAACGTCCTTTGTATCGGAGACCGTCGGTGACGACTCCTTGTCTTCGTCCTCTTTATTCGATTCACTCGTTGTCGCATCAGTTGCAGCAGCAT
CCTTTGCATCTGCAACAGTAGTAGATACACTAGCGTCGTCGGGTGCAGCCGTAGCGTCTGTTGGATTGACCGCGGCCTTGTCGTCGCTCTGCGCAGGCGT
TTTTTGCTTGTCCTTGGCGATTCCGGCCGCCTGCAGCAGCGTGTCAATCCACTCGCGCACAGGATGTCCTTGCGCGTCCGTGGGAGGCTGCAGCGCTGTT
CCTTCCTGCTTGGTTGGCGGATTCTCGGCCACCTCGCTCATTGCGCCAAGCACTCGTTACGCGCAGGTTTTGGGATGGATGGTGTGAACCTTGTCGCAGA
TTTAAGATTTGTGTACCGCACATCGAGTAGTGTGGAATGCACACCAAGTTGAAGCATGGCTGGCACTGCGCGGGACACCGACGTGCCCAATATGTTCGAT
TCGACACCGACAGTGCCCAATATGTTCGACAGTTGACGTTGCAGTCATGGATGTCACTGCAAGACGTGCCAACGCTTGCGTAGCCCGCAATGGCTGCGCT
TGGAGGACTCGGGCGCTCGCCACTGGATGCTCCGTTTCGGATACGAGCGAGTTGCACACTACGTGTAGTGCAGGTGGGTCCAAGTCGGCGTCAGTCGCCA
TCGCCATCGACTACGACCTGAAATGCATTACGCTGCTGTGGATGATGGCTAAGCGCTCGGAAACATCGCAACCCGGAGACGTTAGCTTCCACGAGGCCGT
GCTCAGCGTTGCAAAGCCAACAGCAACTCAAACCGTTGGGCTGCGAGCTAGAGGAAGATTGTACTCTCGACAACTACAGCATATGCGGCGAATGTCGCGG
TGTGTTCCGCGTTGCTCAAGGCGATCAACAGTCCCAATCAGGATAACGTGACTGTGCTAGAAAAGGAATTGCGGCAGCTAAGAGAGCAGAAGCCGCGGCT
CGCAAGGGGAAAGCAAATGCACGGAAGATATCAAGCTTAGAACGAGGCAGCTCCTGGTCGCAAAGCGCGTGTTGGAGTTCCTCAATTCCATCGTTTGATC
TATTTTGCGGTTGGTTATCCTCAGCAACTCGGCAAGAAAACTATTGACCGATCAAACGCGAACGAGAGGGAACGACAATTTATTTGGGGCTCCCTTTTAA
ATACTAAACGAGAACGTTCGGTCCTTCTGTTGGTGTCGATTGCTGGAAGCAGCACTGCTCCGATATTGTCATGATCTCTCGGATGCACACCTGCGGTGTT
AATGGTCACTCACTACATGACCGAGCATCCAAACCACGACTCATCCAAACCGTTGGCAGCCATACCTTCGACTTCGTTGCCCAAGTGTTTCATGGCAGAT
GCAATATTCGCTTCAAAGTACGGGTGCCACACGTGGTCATATAGGAACCGCGCAGTGAATGACAGGTCGTCCTTATACGCTTTAGCGACCTTGGTGCCAC
CCCAGACGCGACTTCGCTCCACAATCCATGGTACCATAACGCGCTTGGGTTTGGTCGCGCGAAAGATACGCGGCATCACATACCGCTGGAAAGCCTTTTC
TGAAAATGCGAGCTCGATAGCGGGCTTGAAGGCTTCTTCTTCTAGCGCCAGCACGTTGAAAAGCAGGTGGTTGAGACGTCGGATATCGTCCTGAAGTAGA
CCCAAACGAGCTTGCCATGAATCCGCTGACGAGACTGCTGATAGCAGCAATCCGTCCTCCTGCTCAACGATCACATCCACCAATGTGAAAATAGCTTGGT
ACAGGGCAACGATATCACGCTTCTCCACAAACTTGATAACCACGTGCGGAAGCAGCACCTTTGTTTTCACGTCGTGCTGGTTTCGGACAAACTCGACGAA
GTGCATCTTGAACCAAATGAAAAACGCGCCCACGTTCCAGTTCATGGGCGACTTCAAGCTCCGGCTGCGCTCCAAGAAGCGATCGATTACGAAAAGCGCG
TGCCGAACTGGTTCATGCAGTCCCAGCAGGAACTGCGAATTCCAGCTCATGTCGACTTCATCCTTGTGCGTTAACACTGTCGAAAACACTACATTCTCGC
CCTTGCGCTGCGGGGCGGACACGGGAGCACTCATCACCATGGTAAAATCGTCTCCTGAAAGCTCTCGTCGAAGCGCGCTCGCATCCATTCTCAGTGGCCC
GAGACTCAACTGACTAGACGACGTGGCCACCGATGAACATTCCTCGCTGCTGTGTTCGGAAATGGGCGTCGACATATTACTAGCGCTCTGCTGCGTCTTG
CTCATCATGGCGGCGTTTTTGGTATTCTGTATCGATTCGATGGACGCCCAGATATTGAAAAACGCCGTGTCGGATGGGACTTCGTAGCCACTCTTGTAGT
CAATAGTCGTGAGTACGTGCGCTACCTGGCTGATGTCCACGAGCTGCGTCGTCTTCTTGGAAACACGCACGTCCCGCGTGGACTCGGGTGGCGACCATAT
ATTGCTGTAGAAGACGGTCTCATCGCCGGGAAGGCGGCGCGGCTTCTTGACGCGCTCGCTGTTGGCCACCATTGCCAATCGGCTTTTCACGAGCGGTTTA
CGTTTGACAGGCTTCACTGCCAGGCTGCAGGACAACACGGGGAAGTCTTGGTGCATGGGTTTCTCCGGCAGGTGCTCTCTGCCAGGCAACTTGTTTCGCA
CTTGAACCGGCATGGCCTCCCCCCTTCTTATATCGCTGCTTCTCTCTGCCTCCTTACTTCACTTGATCGAGGGAAATCCACCAGATGCCGCACTCCGCTA
CCTGCCAATGGGTCAATGTTCGTGTCTTCTCTCCGTCGAAGAGCGAGATTTCTTCTGAGCAGGCAGACAGATGGGAACGACCGAGCAAGCGAGAGAAAGC
AACAAGTATCACAGTGAGAATGGCGTGTTGCACACGGCAGGACGTGGCCTGTGACTGTCAAAAGGAAAACATGTGCAGCTACCAACCGGTCTCGACAACC
GCACCCACAGTCGTTACTGCCGGTTTCGAAGTGAATTGAAGAATGAGGATATTTTGGTCAATGCGGCAGAGAGATTTCCACCTGCAATCGAGACTTGGGG
CAAGTCTCAACGCAGCCAGCTGGGGGGGTCACACCATGTCTCGACCTCCAGAGAGCGGTCTTCCACGACGATGGATGGAGAAGCGCTCGCTGCCGAGGCA
ACCCACGAGAAAACCGATCCCACACACGT