Description :
From Genome Similarity Track
Location :
contig_3:405549- 406920
Transcript NameFunction/comments
g1004.t1XP_008901969.1 hypothetical protein PPTG_08965 [Phytophthora parasitica INRA-310

Sequence
1371 bases(100 bases per row)
ATGAGCTACAACAACCGGCGAGGAGGATTCGGAGGCCGCAGTCGCGGGCGCGGCAATCGCGGCGGGCGGGGCGGCTATAGCGGCGGTGGACGCGGGGGAT
ACGGAGGCGGCGTGGGCAACGAGGTGTGCAGGCGCTTCATGGATGGTGGCAAGTGCGAGTTCGAGCAGACGTCGGGCGGCCGGCCGTGCCGCTACCCACA
CTTTGTGCGCACCATCGGCGAGACGCGCGGTCACAGCGGAGCCATCAAGGATGTGGCCATGTGGCCCGACCGGGAGCAACTATTCACGTGCGCGGCGGAC
GCCAGCATCAAGCTCTGGAACTGCGCCACCTGGCAGGAGGTCACCACCATCAACGTGCAGGACGCGCTGCCTCCGTCTGCCAACGGCAATGGCAGCGGAG
GCCGAGGAGGCAACAGAGATAAGACACCGCACACGGAGGGGGTCGTGGCCCTCGTGATCTGCGGGCCCTTCCTGTTCGCAGGCTTCGAAGGCCGCTTCCC
ACCCAACCCCAAGGTGTCGGTTGGAATGGTGCGAGGGTGGAACCTCGAGAATGCTCAGGCGCCGCCCTTCGAGTTCGCAGTGTCCGAGACGATGCCATTT
GCTCACACGATGAACGTGCAGGCGCTGGCGGTGGCCACGGACCCCACGGGCAACGCCACGCTCTTCAGCGGCAGTGCAGACGGATGCATCCGTTACTGGC
AATTGGACACAGCCAGCAATCAGTTCAAGTGCCGCGGAGTGATGGAAGGACATGTGCGCGGAGTCACGAGACTCAAGACTTTTGCGGTGGGCGGCGCGCC
GATCCTCGCCTCGGCGAGTGTGGACTCGACGATCCGGCTCTGGGATTTGGCCACGTACCAGTGTGTTAAGGTGCTATCGGCCGAGGAAAATGGCCATACG
GATGCCGTCATGGACCTGGAATTCTGGGTGAATGGGAACGAGACGTTCCTTATCAGTGGCGGCTTGGACTGCGAGATTATTGTGTGGGGCCTCACGCCGC
CCTTCCAGCAGCTTTTCAAGGAGACGCAAGACTCGCAGGTCACCGCTCTATGCGGCACGCAAGACGCCGCACAGTCTCCCATTCTGCTAATTGGCATGGC
GGTAAGTTCGTGTGTTTTGAAGTTTTTGCTGGAACTGTAAGCCTGATCTTGTAATTTTTGCTGCTGTGTCAGGATGGCACGATCTCAGTGAAGGAGTTGC
CGACATTCGCGTATAAGACCACACTGGGTGCCAATGTCAACCATGGCATCAGGATGCCGTACGACGTATCACTATAGGCCCAAGCAACACCTTCTTCTCC
GCAGGCAACGACCGCAAGATGATTGCTTGGCAGATCACGGGCGACGTCGCCTCTATCCAGTCCAAGTAAAC