Description :
From Genome Similarity Track
Location :
contig_3:405536- 406907
Transcript NameFunction/comments
g927.t1OWZ18383.1 hypothetical protein PHMEG_0007534 [Phytophthora megakarya

Sequence
1371 bases(100 bases per row)
ATGAGCTACAACAACCGGCGAGGAGGATTCGGAGGCCGCAGTCGCGGGCGCGGCAATCGCGGCGGGCGGGGCGGCTATAGCGGCGGTGGACGCGGGGGAT
ACGGAGGCGGCGTGGGCAACGAGGTGTGCAGGCGCTTCATGGATGGTGGCAAGTGCGAGTTCGAGCAGACGTCGGGCGGCCGGCCGTGCCGCTACCCACA
CTTTGTGCGCACCATCGGCGAGACGCGCGGTCACAGCGGAGCCATCAAGGATGTGGCCATGTGGCCCGACCGGGAGCAGCTATTCACGTGCGCGGCGGAC
GCCAGCATCAAGCTCTGGAACTGCGCCACCTGGCAGGAGGTCACCACCATCAACGTGCAGGACGCGCTGCCTCCGTCTGCCAACGGCAATGGCAGCGGAG
GCCGAGGAGGCAACAGAGATAAGACACCGCACACGGAGGGGGTCGTGGCCCTCGTGATCTGCGGGCCCTTCCTGTTCGCAGGCTTCGAAGGCCGCTTCCC
ACCCAACCCCAAGGTGTCGGTTGGAATGGTGCGAGGGTGGAACCTCGAGAACGCTCAGGCGCCGCCCTTCGAGTTCGCAGTGTCCGAGACGATGCCATTT
GCTCACACGATGAACGTGCAGGCGCTGGCGGTGGCCACGGACCCCACGGGCAACGCCACGCTCTTCAGCGGCAGTGCAGACGGATGCATCCGTTACTGGC
AATTGGACACAGCCAGCAATCAGTTCAAGTGCCGCGGAGTGATGGAAGGACATGTGCGCGGAGTCACGAGACTCAAGACTTTTGCGGTGGGCGGCGCGCC
GATCCTCGCCTCGGCGAGTGTGGACTCGACGATCCGGCTCTGGGATTTGGCCACGTACCAGTGTGTTAAGGTGCTATCGGCCGAGGAAAATGGCCATACG
GATGCCGTCATGGACCTGGAATTCTGGGTGAATGGGAACGAGACGTTCCTTATCAGTGGCGGCTTGGACTGCGAGATTATTGTGTGGGGCCTCACGCCGC
CCTTCCAGCAGCTTTTCAAGGAGACGCAAGACTCGCAGGTCACCGCTCTATGCGGCACGCAAGACGCCGCACAGTCTCCCATTCTGCTAATTGGCATGGC
GGTAAGTTCGTGTGTTTTGAAGTTTTTGCTGGAACTGTAAGCCTGATCTTGTAATTTTTGCTGCTGTGTCAGGATGGCACGATCTCAGTGAAGGAGTTGC
CGACATTCGCGTATAAGACCACACTGGGTGCCAATGTCAACCATGGCATCAGGATGCCGTACGACGTATCACTATAGGCCCAAGCAACACCTTCTTCTCC
GCAGGCAACGACCGCAAGATGATTGCTTGGCAGATCACGGGCGACGTCGCCTCTATCCAGTCCAAGTAAAC