Description :
From Genome Similarity Track
Location :
Scaffold_1:4055149- 4057623
Transcript NameFunction/comments
Physo_478390PREDICTED: uncharacterized protein LOC100494154
Physo_473822Hypothetical protein

Sequence
2474 bases(100 bases per row)
TCGTAAGGCTGAGCTTGCTGCATCGAGGCGACCAGGAGCGTCGGGCTCTACTAGAATGTGGTCGTCGACCCATTCGTATGCGAAGAATGGGGTCGGATCT
GCTGGATGTGCTGCCATCGTAGCAGGACTCTCGTGTCCAAGCAGCCATGATATCGCTCCGCCGAACATCCCGTAAAAGGCTGGAGATCCCGTCCATCCGA
ATGGGGCCGACATGTCGATGATGATAGCGCCCAGTTGTGCAATGCGTGCTCCCATCCAATGGACACTGCGTGCGATCAACTGATGTGCCGGAACGCTCCC
TTCACGTCGCCTTTCATTACGTAGATGGTGATCATTGGGTTCTGCGCGTAGCACTCCTCAATTCTTCTCGCGACTGCCGCCACGTGCCGGTACCGCACCT
CTGGGAACGAGCTTTTGTCCGATGCATCGTTGGTTGAGTTGCCAATAGGGTATGACAGGTCATGAATTAGGCGAGTTTCGAGCTGGGGGTCCGTGTTTGC
TTTCGGGACTGCATCGAGCGGGCTGATTCGAATGTTGCCGAGTGTTTCGAGCACGTTTGCGTCCAGTACCAAATACTGTCCTCCGTCTTGGCCTTCGCGG
ACGCTTTTCACCACTGTATTAAGGTGGCGATCGGCAGACTTGTGATTTGTTGGAATGCGCTGCTGCTCCTGCTGCTCTTGATTTTGCGTGGACCATTGAG
GATCAATGCCAAACCGTGCTGCGCTGCATAGTGAGTCGCGGTGCTCGAATCCCTCCAGTAGTCGATGAAGACGGTTCGGGGATAGCGCTTTGTTCGGGCG
GGGGTCCTCTGGAGACTGGCCTTTTTCGAGCTCGACGACTTGTTCAAGTGTGAACTGACTTCGGGATATGAGGCGGGAGAACCCATGCTGCTTTTTGTAG
TGTAGGCAGTATCGAGGGACCTTGCCAGTGTGATCAGAGGTCTTCGGCGCCGCGCTTGGCACTGCGATTCCTTCTCTCCGCAGCACATGCGCTATACGGA
CGTCGCGTTTGGTTTCATCTGCCTGCAGCTGGCGCTCCAGCATGGCCTGGACCTTGACGCAAAGGCATCGAAGACTGACATGGGCTGGCCGGTCGTCCGA
AGCCTTGATGGTGTGGACACTCGGGTGCCAATGCTCTGGGAGGTTACCGCGTTTAGTCCGTTCGATAGATAGCGGTTTGCAGCTCTCTCTCGCCGGACTG
TGGGCGCTCAGCTTCTGCTTCGTGATGCCTGGGGCCTTGCCAGCGCAGTGTTCATGGCTGCTGGCATAGTCAGGTGGAACGGCGCTTGAATAGGAGTACA
TCCCGTCGTTGATGGATGCGTTGCTGTCATACGCAGTCGCCCTTAAGCCACAGAGGCTTGCGTTCGTGGCGGTGGGTGGATCGCTGGGTCTTAGCTCTCG
CGCGAAGTCAGGAGGTTTTTCCTTTATCCTGGGCGTTCTGCAGGTGCAGTTGGACTGATGCGCTTTGTGTATGAGTAGACACGAGGACTGTCCTAGTTGT
GAGCGATCATCACAACCCGGACGCCATCAGCTGGACTGCGAGAACTTGTCGCTGATCCCGCCCAGTTTTGTGTTGATGCAGTCTCGCACGATGGGGTCAA
TTGTCGCTGGTTCAAAGTGTACCAAGTTGGGGAACTTGCACACTGTTGGGTCCGCCGATGCACACCCTCGCTTCGAGAGAAAGCGAAGGCACACTTCTTT
TCCGTCCTTGCGTGGTAGCGCTACGACGACTGCCTGGGGGACCTTGCGCTCCGACGGCTGCTTGACGTGTCGGACCTTCCCTTCTTGCGGTCGCCACCGA
GAATCCTCGCGTGTAGACGTGCTCTGTGGTCGGTTTGACCGTTCTGACAGTGCGGTTATTAACAGGGCCTGAAGGTCTGGGTTGGTCGTGGTAAACCACC
CGGTTGCCTCAAAACGGGAATTACCGCCTGAGAGTGCATCCTGGGCCGGAGCATTGCGATAGCGTTCCAAGGTGGCGTTGATCCAAAGTACGAGAGTAGG
AATCTCCTCAGGCAACCAGTGGTTCCAGCCTTCTAGCTGCAGAGCAAAGTTGTCGAGAGCCGCCGCTACCCGAATCGTTGTGGGATCACACATCTCGCTG
CAGTACAGGAGGAAACCTCGCGCTGCCGAGTGCAGCTGTTTCCATGAGGTCATCACCGGCGGCCGCGGAATCGGTAGTGTGAAGTCAGTTGTGTCCACTC
TGCCGGTGGCTGCGTTGCGAAGCCGATTGAGGTACCCGACGTGACCGAAGTGACTTAGTGACAACCCCTTAGAACCGAAGCCGATGTCGTACAGGCGGGT
CAGCATCCCTGGGTGAAAATCAAGGGGTAGCGACGAAGTAGTCAGATACTCCATGTACTCCTCTCCGCTCTTACCTCTGTGAGCATCCGAGGTTATAACT
TGGTGGACTGTCTCTTGGTCTGCGGTGGCGAAGAATGCTTTTTTGTTGCGCTTGGCTGGTGCTGGATTGATGTC