Description :
From Genome Similarity Track
Location :
scaffold_14:405491- 410038
Transcript NameFunction/comments
Plaha_PHALS_08224hypothetical protein

Sequence
4547 bases(100 bases per row)
GACATGTCAAAACATGTCTAACCTACTGATTTGGTATCAAAACAAAGTGTTTTGATACCCTAAAGTAGTTCCGTTGCAAAATGCGTGCTAAAACGCATTT
TGACCGAAACTTTGACTCGACACTACAACTAGATAACGTGGTAATCAGCGGTTATAATCGCGAAGGATTATAACTATCGTGATTACAATCACGTTTCAAA
GTTCAATTGAACTTTGACTTGACCAATTGATGGTCAAAACCGAAAGTCAAACTNNNNNNNNNNCCCATCGAcatacacccctgttaccagggtacgtgaa
accccgttacaagggTAGAGCCACTTATTATATATTCAGTCTATACTTTGATCAAGAAAGCCACACACGGTTATGGTAAAAGGGCATATACGACAGCTAC
GCGAGAAGATTATGCCTCAAGGTAACACTACCTCAGCGCATGAGTGCGTGCAGCAAGCTCTCTCGTTACAGGATTAGGAAtccatatatatatagaagTA
GGAGTAGCGGAGCTGAGCTGAGTCATAATGGTACCGAGTGAAAGCACATAATTTTGACATGAAATAGAAGCTACTGGCTGTCTAAATAAAAGAAGTAGAT
CCAGGACGCGACCAGCACAAAGTCCTCACCTTGCCAAAGTAATcactaaataaataaattaccGCACCAAGGCTGTGCCCAAGAGTGGATATGAGCTTCA
CATCAAGATATTGCGCCGAAAAATTTGCTCAACGATAAAGGAACTGTTGCTGGCCAATCTGCAATTGCAAGGTGTAGACTCCAAGCAGTCGACGGTGTGC
AGGTTCAGTCTTCATCATTGTCGGCACATTCAAGTGCAACATGCGAGTGCACTGCTTTGCGAATTTCGTTATAGCGGACAAGGAGATCATTGTGCCTGAA
GTAGGTGTAAATTCTGAtgttagggtgcttcatttgaGTCAAAGTTACCAATATATCATCCTTTCTTCATTGTTTATGTGAATTGTTCACAGGGTAGCAC
CTATAATCTGGGTCAATCATGCGAAGCTATGATAAATCTTAATTAATTATAATTTGCATGTGATCTGGAAAAAGCAATGCTGTACGTTAGCTTTAGTTAA
ACATGCAGTATGCTTACATGAAACACGAGACTTTCATGATGATATGCTCATTCCGTTTTGAGTCTTGTTGAGCCCACCACTTCACTAAaaaatacatttt
gaacAATTCTATCGTTTTATGCTCTTTCTAAAAGTGATATGATACTTAACGATCGGTTCTGCATACATCACGACGACGTTCATTTAGTGACACGGTGTGT
AATGAAATGTGTCAGATTAGCCTGAATCCTTTTTCTCACGACATTTGCAAACACTTCGAGCTCAGAGATGTATATATTAACGACACTTGTTAGGATAAGC
CTGGGAACACTCGATGCGCCGACTTCATTTGACAGTGGACCGTGCTTCCGATCAGTTCTGTTCTACAGACATACAGATTGGCGTGTAATTTTGTACAGCA
ATTTCGCTGATTCAATCAGTCGTGAGCACCGGCTACTAGACGTGCGTCATGGAATGAAAACGTAtgtcaaaagacaaaatACCAACTTAGTATTAGTACA
GAGTATGGCATACCTGAAAGTGTCGATCCCGTGGATACACCTAGCAGTTAAAGCAGATGCAAAAGCATTATTTTCATGAAGATTCAGTGCACGTTTAATT
TTATCGTTGATTTCATATAATGTAGCCATGACAAACGTGTTGAGATACATCACTAAAAGTGCGTGGAGGTCGTCACAAGTATTACGGTAATAAACGGGTG
AAGCTCACTTGTTCATGAAGGTGGCAATAACTATTTAAACTGGTAATTTACTACCTTGTTTTTGAGTGGACAGAATCACATCAAGATCAAGGACATACGT
CAGAGTTGTGGACTTCATAACTCACACGAAACATGTATTCGTCGCATGAAAAGCAGATTTGGTGTTTACGACCACATATTTGTGCGCACCTTTAAATATA
ACACTAAAGTATAACTGACGAATATTTGCATTATCTCATGCATCAAATTAGATTACTTGCTGAATTTATTGAATTAAGCGCATGAATAGTGGAAATGTTG
CCTTTGCTACATATTGTCACATTTATGAAAATTTAATACTTTTCACGCACATACATCATTCTTCTCTAGATGTTGCACACATCACAATGTTCACGGGGTG
CAAATCCAATAGTTTTATCAAACTAAACATCCAACATGTTGTTCTTTATCTCCTATCTCAGGATTTATACTATTGCGATGATAGATTCAAAAAGGTGCAT
AAACACAATTGCACGATACTCACCTCGTACAAAAATAGTCGATTGAAGATCAAATTCTGATGTCCTACTCTATAGTACAGTGGTCGTCAAGCGTTTGACT
CTCCCAGAGATTGGGCTTAAAACTTAAAATGGAGCGCTTACGGGAGAAGCACAAGTGGATATATCTAATCACACATGATGAGCACTAGTAATACGGTTAC
ATTTAAGGTCAGTGATTACGGGCGCGATACGGTTAGTGATTACGCACGCAATGGCAGTCGCTGANNNNNNNNNNCCCTGTATTGCAATAGTGTATTCGGG
AACTAAGTCAGCTTTATGAAGCACTCCTTTATCCGCAGGTAGCAAGCGCGGTGGGTCTACCGGTACCGCGTTGTTGAACCCTATATACAAATGATAGAGT
GGATCAATTGAAGCTTTGAGGATAGCTGTCAGACAACCTGCACCACGACTTTCTCAAGTCATATTCCTGGCATGTGATAAGCTCTTCCCTTCGTGAATAC
CATCTGGACCATTCGGTGAGCTCATCGACTTGCCATTCCTCGCCCATATCACGACGTATAGTTCCTTCAGTATGATAAGGGCCTCTGTCGAAGGTAGAAA
GGGGGGGGGGCTAGGGATAGGAGACTTACAATGTAAAAGTACCCCAGTCATATAATTCACGAGTAAGCAATTTTCTCACCATACACTCGTGACGATTACT
CAGCACTTCCACCGCATCATGAATTATACTTCGTATCTTTAAGGCATATCGTTTCAACTTGTAGCTTTAAGTCACCCGTCGGCTCCATCAGCACAGAGAG
AAACATCTCACAGATGATCTCTACCATCCCGCCTAGGATACACCAGTACACCACAATGTTAAGCCGCTACTTTTCGCCCTACCGAGACTCAATTTAAAGA
CCGCAATATGCAATcgttttctttttcatcctAGAACGGCGTCTTACTGCCGGTTCTGCCTTCCGAGCTCTCACCCAAGTACCTAGTAATAACATTACTA
TCAATTTCGGACCTTCTTGTGCCCTGCACGaaagctatcgcagcttcactcgcgcgccaaaagcgctttatATCCTGAAAGAGCTGGACACAAGACTTGC
CAAAGTATCCAAGGGTAGGTCTTCTCAGCGTCAAGACGATCTATAACTCGTACCGGTCCAGCTACGCCAATTCGGGTCCAGGATAAGACAACGTTTTACT
CCGTCAAAGTCCTCTCAATCATCAGTCAAAGGCTTAATGTAGCATTTGACACTAATTATTTTGTCCCTGTGGCACGATACACGTACATCGGCTTCGTATT
TAGTGATTTAAATGCCTTTAGGCACTGTCTACTGATTTTGACAGTCCTGCGTCGTATTTATTTGCAATACAAACTTGAAGCTGTCAAGACTTTTAACGAC
TTTACTTAGACCAAAAACTAGATGATTCGATTAGTCTTTCGCTCCTATACGCGAGTCCTAAAATGTACAAACGGCAATCCTGGACTGCGATCCCCTCTCT
CTCTCGAATAGAGTAACCCATTACGGCTTGGTTGGACTCATTGTCCACGATCTACACGCGGTACAATAGAGAACAAAGCACATTCCTTttacccaaacaa
gaatacggtatgtggctaggttgAAAGtagttttgcatgtatttattatatatatttattatattgaggaaaatctaaacattaaaaataggcggctttg
ccgcagataaaaataaataaaaatcagtttgaattttaaacggaagagctaattagcatTCTGACTCGTACtttttctaagtatagaacgaatgaCCTAA
TTTACaattcctctaagcgcgaAGCTACGGTTCCCCGCTGCAGCTACACACAATCGATATACCCATTGCGGTGACTTTGATATAGTGTTATATGGGGTAG
ACCAGATGTGATAGCCGAGTTCGGACTTTCTTCACAAAGGTCGCGCTACGATACCCTCTTATTGACTAAGACTCTCCGTCTGTCGCATACTAATCGCAAA
ACATGTGTGTGCACTCCTTTTTAAGTAGGCGTGTCACTTCGTTGTTCGTGCCACTTTTGATCTAAAGTTGTAATATCAATGTTTGAATTGTTTTTCGTTG
TTTCATACGGTTTGAAAGTATCTGTCAACCTTTTGTATCATAGATGAAGACGTTTTTGCTCAATTTCTGCGCATAAAGAACCGTTATGCTTTATCCGATT
CACATGCAAACAAAGTGTCAGTACACTTGAACATGCTTCGCATGCTT