Description :
From Genome Similarity Track
Location :
Scaffold_23:40542- 43056
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_23-snap-gene-0.33DNA polymerase epsilon subunit
Pytir_DAOMBR486maker-pir_contig_23-fgenesh-gene-0.19Gene of unknown function

Sequence
2514 bases(100 bases per row)
AGAGTATCTTGGCTTCCAATGGCGAAGACGATCTCTCTGTGATCCAAAGAGCGCCCGAGAGCGCAATTGATCTGACGCAGCTGGCGAAGACCCTCGGCGT
GGCTCCGATCCAGTTCAGTTTTGCCCAGTCCTCAGGTACGATTTCGCTGTGAACTTGTTGATTTTCTTCCACGGCTTATTCTGTTCTTGGGCTCACGCTT
GTTCACAAATGCTTTTTTATATCAAGACGAATTTGACGCGGTCTTTGCTGGCGTCTGCCAAGGGTTCACTGCGTACTTCCAGGTATGGTTTCCGACACTT
CAGTATAGCTTCCCATACCCTGATTTTGATGATCCTGAACGACATGTGATTCAATATTAGGGTGAGTACGAAGAAGCGACCAAGCTGCTGCTGCCTGTGC
GCGGCAACCTACGCGTTCTCGGCGGCACTGCGGTCGAGCACGAGCTCGTGGACCTCCTTCTGGTAGAATGGTGAGTGCAGTTTCTCTTGATTTCACCAGT
GAACCCCAGGGTTGTCTTTTTTGTAGTGTAAAACCCTAGAGAGGTTGGCTGACCTCCACTGTTTGTGTATCATCACTAGTGCGAGCAGATGCGAAGACCT
GACGCTCGCGCGTCTTCTCCTCAACGAACGGTATGGGTACTTCTGCTATCCCCACAGCGCTTTTGTATGGGCTATCCACTAACCAATTCTGTGTTACAAC
CTGTCTTTATATGTTGTTGTTGTTGGTATTTCTTTCAGACTGAGTCTCCGTTCGCAGAGTGCGCAGGTCTGGAGCGCGTACTCGCGCATCTTCGAGTCCA
TCGGCGACTCGTCGGCGCTGCGCGACGCGCAGAACATGAGCTACGTGCTTGGGCTCGGCCAGGGCGGCAATCAGACCAACTAGAGCGAGCGGTTTGACCA
GCGAGTATTCACACCAAAGCAGTACCTACCTTACATGGCGAGCTAAATAGACACTGTTGCAAGTCCGCGAATCTGGCGGTGTATTATTGTATGGTTGGTT
AGTTACATAACCTGACATGAAAAGAGCGCGACGTTCACAGTCACAGAGGTGTAGTCCTCGTTCTGTAGGAAGCTTGCGACGAGCGCCGGGATGTGCGCGT
GGCCCTGGCACTCGCTCTGGATTCCGGGAGTGTCGCCACCAGCAGCATCAATCGTCACCATCGTTCGTGCGCTCTCGAGGTAGTTGTTGAGGCAGGTCTC
GATTTTCTGCAGCATGTCGTGGATGCGGTTGGCGTCATTGGTAGCACTCCTATTGTTGACGACGACGGTGAGCGCCGCACCTCGATTCTGAGACGCCTGC
GTCTCCTGTTGCGAAGGTTCGTTCCATCTCCAGAGCTTCAGCGCAGCCGGCGAGTTGAACTGGCTGCAGTACCCGCAGCGCGACGTGCCGTCCAGCGCTG
TGGGCTCCGGGTGCTTAGTGCTCCACTGGTGCACGGCCGCGTGGACGCTCTTGAGTGTCGAAAGCGCCTTCATGTTCTCATAGTCCACGCTCGGATGGGT
CGTTTTCGCGTCCTTGCGGACCGCTCGCGCAGACAACTGGGCGGCGTAGCTCTGGTCCTTCATGACCACCTTGAGCTGGACCTGCTCGTGCTCGTCGCGG
TAGGTCGTGCCCGTGACGTGGATGCGCTCAATGCGCGCGAGGAACGCAAGGCTCTGCGCCGCGCGCTCCTGCTGCTTGCGCTGCGCCTTGGAGGGCGACA
GAGCGCCACCGTTGGCAGTGACGGTGGCCGTGCTGGTGCTGATGGCGTCGCTCTTGGTCGCCATTGTGCTTCGTGCGAGTTTTCTCACTGATGTTTGTGC
AGTCAGTCGAGAAGGAGAGCGTGAGAAATGATGGCCATCATCAATGCAGCACGTCTTTTTGACAAGCTGCTGTCACTAATAAAGCGGTGACGACGACACT
ATTTCTTTTTCGCTGAATAAAAAATAGTGACATTGAAGTGATGGACATTTTGTAATTGTATGCCCCACTTGAGCGAACCCGCCATTTGAACTGGAAGCTG
TAGTCTGCGCTAAAGTGCTCGAGTGACGACGACGCAGCAGTGAAGACGACCCAGATTAGTAGCTCAATAATGCACGTGGGAGTGCAATCGAGAGGGGCGC
TAGGGAACTGATCAAGAGTCCAAGCCAATCAGTGTGATCGCTGTGCTCGGCGTGCTTGGCGTGTTCCACATAGTGGCATCAAGCAGTGTGATTGCAGCGA
GGCACGGCAGTGGCGTGAAGATGACAGTCATCCAGACACGAAGTAGTGTGGCGGGTGTTCGTAGTCTTGCAATTGGCGCAGCGAGGCGAGCGCAACATTA
AACATATTATTGGCGTTTATCAGTCCACTAACAGCCATGGTCCAATTGAGTTGGTCTGAGAATGTTTGCCAATTTTTCACATGTCGCAGATTATCTATGT
ACCTATTTTAACATCGACCTAAAATAGGTGTAGAACCTATCTATCATCTTGAAAAAAGCGCTCCCAAGCTCCCGCCATTTTCGTTTCGCAATTGGAGCAA
TCGGCCAAAATCGG