Description :
From Genome Similarity Track
Location :
Scaffold_1:40537- 45538
Transcript NameFunction/comments
Phyke_g146hypothetical protein PHYSODRAFT_472499
Phyke_g147putative RNA helicase

Sequence
5001 bases(100 bases per row)
AATAATGGAGCTGAAGACACCTCTATCTTCCATACAGGGTCGAGAATCGAGGATATGCCGTTCTGGAAACAATTCATCCGACTGCCGTCAAACTCGCTCT
TCCCAAGAGTGTTTACGACTGACAATCCAAGAAAACCATACAAAGATTTCCTCTATGTGCTGCTGAATATGCGCTGGCCTATGCTGCTGACAGTGCTGTT
GGGCGTGTTCCTGGTTAATATTTTCTTTTTCGCGGCACTCACGTGCTTTGCATGTGGAGAACCGACAAATTTCTTCGAGGCGTTTGATTTGAGCTACCAG
ACTTTCACGACAATTGGCTTTGGGGTAGTGTACCCCATGCACACATGTTCGAATATAAGCATGTCGGTGGAGTCATTCGCGTCCATGATGATTGTGTCTG
CTATCACGGGTCTGGTGTTTGCCAAGTTTGCCAAGCCGCAGGCCAAAGTAGCGTTCAGTAAAGTTTGCGTCGTGCAACCGTACGGCAAAAAGTATTTGGC
ACTTGTAGTGCGGGTGGCCAATGCTACGCAGTCACGTGATGTGACCCACGATGTGATCATGGAGGCTGTATTCAAGGTCAATTTGTTGCGGGTGGAGCAC
AAGACAAAGCACGTTTGGGATCACGACGAAGAGGTATCGGAAAAGAGGAGACTATCGCGTGGAGCTAGCGTTATGACGATGCAGCATGGTGAAGATATAA
TGGACGAGGCCGCGTACTCGCGCACGAAAGTTCTGACGTCGTATAatctcaagctgctgcagaacaaTTTCATCACGTTCCGCATGGGCGTAGCTGTGGT
GCATGTGATCGACGAGAGCAGTCCACTTTACGGGATGTCAAAAAACGACATTGCACAGTCCGATATGCTCGTAGAGGTTGCCATGTCTGGCGTCGACTCG
ACATTGCAAGACACGGTTTCTGAGCGCTACATCTATACGGCAGCCGACTTGGTGTGGGGCTACCGTTTTGCAGAATTGCTGGAGTTTAACGAGAGAAATG
CAGAGGTCATCATGAACTTTGCGAAACTCAGTGCAGTGGATTCTGCCCCGATCGATGATGCGCGTTATCTCAAGCCCAAACTGTCCACGGGTTTACCTTC
CGACAACTACGAGAGTGCAAAGAGTGGATGCACACACGATGTGGCTCGCCGCCGCTCACATAAAAAATCGAGGGCACCTCACGACCAAGAACAAAACCAC
CCATACCATGACGAGGTAGTTCATGAGGTCCCTGACGAATATTCGGAATCTTTCATGATGAGCTCGAGGTCGGATTCCTCGGATACACAGTCATCGACGG
ACACCATGGAACCAGCGCAACCGCATTCTTCGGTGCTAGCACGGAGTAGAACTGGGCCTACAATATTTGCCATGGGTCTCGAGCCGCTGTATGAGCCTTT
GTTGCAGCAATCATTCGGAACGCAGCGTATTCCCaaagcttcttctgcagaaAAGCTTGCAGCCCAGAGAGGTGGTTTACGTATCTGGCGGACCGACAGG
GTGGATGGTAAAAGCGATCAGTCGGAGCTGGAGGGAGGGCATGGTAGGAATAGTGGAGGAGTACACCGGTTATctggagatgatggcgcAAATGTTCTTG
CCCGTGGTGGCAGTTCATCTAACAGTGGTAGTGAAAACGATGGTGATTCGGCGATGGTTGCAGCCCCTATCCGAGAGAAAAGACTGCTGCAAAGAGAAAT
GGCAGGATCTGCCAttgtcgaagacgacacCAGCACAATCTCCCAGGATGAAGCGCACAAAGACGAACTTGATGACGAAATTGAAAGAGACAGTGATGCA
GAGGACGACTGCGAAGATGCGGAGGCAGCTCATCAACACCGTGACCGGACGACGCTATCTGCCGTATCGATCGAGGTAGAGGATACACCTCGCTTCTTGC
GAATTTTGCCCGTACACATCCCAAAGTctttcagcttcttgcgcttttATCAGAGTGCACTCCACGTAGGCTGGCCAAAGATTACCTTCGTGTTTGTGCT
GGCGTTTGTCGTGATCAATTTCACCTTCGGGCTGTTGTATTGGCTTCACATGGGCGGTATATCGTCATATAGTGACGAAAACGTCTCGCAATTCGAGTTG
GCTTTCTATATGAGCGTTCACACGTTGGCCACTATTGGCTACGGCTCCATTGCACCAAAGCCTAAATCGGTCTACATCAACATCGTCGTGTTCATTGAGT
CGATGGTGGGGATCATCACTGTGACGATCATCACTGGCATTGCCTGGTCCAAGTTCGCCCGACCCCGGGCGCACATCCACTTTTCGTCGAAGATGACTAT
CGCGACAATCTATGGCCACCGTTGCCTTGTTTTCCGTGCCGCTAACACGCGTCACTCTGGCGAAGTGCACGAGAATTTTTTCCGTATTGGCGTGATCCTC
ACAAATCGACGCACGGGTTTGCGGCAGATGTACGATGTGCCCCTCGTGACTGCGGAGTGGCCGTCCATCAAGCTGCCCGCGACGCTCATCCACGTCATCA
ACGAGAACTCGCCATTCTATAAGTTCCACTCGATGAAAGAGCTCTCTCAATCGCGTGTGGCAGTCATCGCACTGTTGACTGGCCTCGACACGACCTTCTC
GGAAAACGTGTATGCGCGGAAAATGTACTTCTGGGATGATTTCGCGTACGACATGCGCTTCGAGGACTTTGCCGTTATCGAACGCGACCGTGTCGTCGTG
GATTACGAGCGCTTTGACCGGCTTGTCCCCGAGGACCGCGACGAAGAGGTCATGACAACGCCAGTGCTCTCAGTGAGGTCGTTGTTAGCTGGTGACTTAG
TATAGGCTAAACCGTGTTGTGTACGCTGTGGGTGAGACCGCGACGTATTTCCACATGAAATCAAACAGAATAGGGATCCCACGTGACGCCGTAGCTTACG
ATGTCAACCTGTATGTCCTCACTTTCACCAAATTTCCTCCAACTGAATCTCAGCCTTTGATCTTGGCATTCGCACTACCAAAGCCATCAGCGACAGTTAA
ATCCAACACTTCCTGCTTGGCGACTCTTTTTTTCATGCCGACCAGGATGTTATATCCATTCTTCCCTGACTCTAGCCGCGGCTACACGTGGGGGTCGGTA
CATGACACGATAGGTTGGCCCAGCTTCGTCCAAAGCTCTTTAAGAGAGGAGATTGGGGCCTTGGACATGGAGTCAGCGGAGGGACCGGCCGTGGCTTAGC
TACTGTTTTGGGCACCTTCACCATGGTACGATTGCGCGCCTCTCTCCATATCGCTAGAAGTTTATCTAAACAACTTGTCTTTGGTTTGGTTGCCTTGGAA
ATCGTGTGACGCGGCTGTTAATGGGACCTGTGCGCGGAACTGCCATTGCACTTGAGTCGAGTGGCAAGGGCCTTGGCACTCACTTTCCTTCTGGTCGTCC
TGTGGATAATCGCACTGGTCTCGGATCGTGTTGAATTGGGGCGCGAAATTCTTGGATTGACAACATGACTCAGTCCTGTACATCAAGAATGTTAATGGGC
AGGATttggtcttggtcttgggTCGAGGTGGTGGTCGAATCCATAGTCCTCGCTCCCCGTGGAGCTGGCGCCATTATCGTCCAGCTCCATGACGACGAGG
GGCCAAGTGGAGGGTTACGATGGATGGATGGTTAGACAGTAGTGTAATAATGTGTCTGCACCATAGTCAGATTGCATGCATGAAAAGAGCAAAAATCAAC
GCTTCTAAGCGAAAAGACTAGTTTTTTATTGCATGTTATTAGATGGGGAGACACGCGGTTCACTGACTGCCATGCTCAACCCGATAGCCACCCCTGATGG
ATAGTTACGTCACATACCGAACGTTTACCAacggccacggccacgaccgccgccaccgtagccaccacgaccacggccaccgccgccgccaccaccacga
cccACAAGCGCGCGTAGCTCACGCGGCACTTCTTGTTCGGCTTCTTCCATGATGCCCACCAGAGGTGCAGCCAAGCGGCTGTTGGTTCCAGGCGTGAAAA
ACGAAATGGATGTACCCTTGTTACCAGCACGAGCGGTACGGCCGATACGGTGAATGTAGTCCTCGATATTTTTGGGCATGTCAAAGTTGACCACATAGCG
AATGTCCTTGATATCCAGACCTCGCGACGCCACATCCGTAGCTACAAGAATTTGCGTTCTGCCTTCCTTGAACTCACGCAGCACGTAGTCACGCTCTTCC
TGCGACTTGTTACCATGAATAGCCTTGCACATGTAGCGGGTGTTACGCAGGTTACGGCTCAGCTCGTCGGCGCCACGCTTGGTCTCACAGAAAATGATGA
TACGGCCACCCTCGTAAATATCGCGCAGGTGGTCCTGGAGCGACGAATACTTCTGGTGGTCATCCATGACTTCCACGATCTGCTTAATCCTCTTGTTGGC
CGTCAGGTCAAGTGATCCCACCGTTACCTGGATAAAGTCAGTCAGGAAATCGTGGGCTAGTGTTACGATTTCCTTGGGCCAAGTCGCCGACCACATCAGA
GTCTGTCGGTCCGGACGAATCTGGCTCACGATCTTGCGCAGCTGGGGCTCGAAACCCATGTCAAGCATACggtcagcttcatccagcaccaggtACGTAA
CACGACGCAAGTTTGTCTTGCCCATGCTCAGCATATCAATCATTCGGCCGGGGGTGCAAATGCAAATCTCCACGCCGCGACGCAAGTCAGCAATCTGACC
ACCCTTGGGCACACCGCCATACACACAtgtgttcttgatcttggagCTAGCGCCAAATTTGTTACACTCCTGCTGAATCTGCACAGCCAGTTCACGCGTC
GGGGCGATCATCAACACAATCGGACCATCTCCAGGTTGCAGGTACGGCTGTATGAAACAACATAGCAAAACACAATATGTTAGCTCACACTACACTCTAC
CAGGGGGCACAAAAGCTGCTCGAGAAAGCAAACACAAGCGAGCGCCGAGGGATTTGAGGTGTTCGCATGctgctctttcttcttgtcaccGTCCACGCAC
C