Description :
From Genome Similarity Track
Location :
Scaffold_20:405270- 408359
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007911Similar to Ccdc104: Coiled-coil domain-containing protein 104 (Mus musculus)
Pytul_DAOMBR144PYU1_G007910Similar to TCHH: Trichohyalin (Homo sapiens)

Sequence
3089 bases(100 bases per row)
GCTTTCAATGGCGATCATGATGACGCGAAGCGCAAGAAGGACGGCAGCGACCTCGTGGGCAAAGTGATCGCGTATTTCTTTGACGACGAGGCGTTTGCGG
CCACGTTTGAGCAGTTCGCGGAAGCCAATTGCCTCGCATTCGACATTGAGAGCGACGAGATGAAGCTCGAGTACACGGCCATCTACAACAAGTTCCTCGC
GCTCTTTGAGTCCAAACTGGAAGGTGAGTTGACTCATTTCTTACCATGGTATGGTCTGGAAACATTGTCATAATCTTCGTCTTGTGCATGTGCAGACTAC
ATTGTGTCGCAGGGCGCAACGGTCAAACAGTTTTACGATCTGGTGCGCGAGGCGTACGCGACGAACCGCGAGTCGAGCATCGTGTTGTGCTCCGAGATCC
TCGTCGCGACGGCCGACTTTGACGTGTTTGTGATGATGATGAAGCAAACGAAGGAGTCGCTGCTGCTCGCCAAGCATTAATACACAATACACAATCGTAT
GTAGAAACACTTTTGCCGAGTTCGTTGAAATTGGTTCTTCAAAACGCACAGCGTACGCAAATGGTAGAGGGATCTGTTTGGTAGCCCATTCGAGCAAGCA
ACTCGGTGATTTTGGACGTGAAGAATGTCTCGACTGCCGTCTGTAGCGTGACGACATTGGCTAAGTTATGGACGTCGTCACTCTTTTCTACGAGGATATG
CGAAAGGCCCCCAGAGTAGCTCTTCAGTATGCTAGTAGCTTTTGTCTGGTGTGAGGAAGTTGCTGAGTCTTCATTGACACGTCGTCAGCCACGCAGTCCA
CTGTCATTGCATTTTGCAAGACAACATGCGAGCAAGGCCGCACTGGAGCGGTACGAGCTGGATTGCTTTCATAGATCGGGGATTTCGGATGACTCGATAT
GCTGGCCAACGTGTCGACTGTCACTGCAATTATGACAATTTCCAGCGAGCTCGCAGCAAACAACGTCGACGCCATCACTCTCCTCGCGATGATCTCTAGG
TGAAAAAAATGTTAACTGTGTCGTTCAAGGTCTTCATCGGGCGGCTTCTGTTTTCTTACGCAGCCGCTCGACGAGCGACGGCAATTTCACTTTTGGTTTC
TTCTTCTCGCCACTGGTTCCCCAGACGGCCGTGGAGACACTCGACGCTGTGTTGTGGCCACCAGCAGCAGAAGGAAGAGGAGCAGAATTGTTACTCGAGG
CTTTCACCGGCGGCGCACGTGGTTTACTGGAGCCTTTGTGCATCAATTTCTGCAGTCGGTACGTTGGATCTTGCTCGCGAACCCGTTCGTCTGCAGCGTA
GCGCTGTCGCTGCTTCAGTTTCCGCATCTTGTCCCAAAGCGAAGCCGCCAAATTGGTTGGCACAGATTGTGCCTGCGATTCTGTATCGTGAAGTTGTTCG
TGAGTAGCGTTGTTGTTGTTGTTGTTGTTGATGATGATGATGGCTGTACCTCTGGGGTTTCTCTCGGCTGAAGGCATCGTAATCTGCTGCTGGTACTCGC
AAGGGCTCCGAGAACCTTCATCGCACTCGTCCACAGCTTCGTTTTCTTGATATAAAGCTTCACGATGTTGCTGCAGACCACTGTGATAAGGATACGATGG
GCGTGGTGTAGGCAGCACGGGGTCTTCCCAGCCATCCTCCAACTCCGGGGGCATTTGGATCAAATCGTCTAGGTTCACTTCGCCAAATTCAACATCGTCG
TAGTCACCGCTTCGCCCCACCAGATTCGCTATTTCGAGCGCGTTTGCGAACTTGCGTCGAATGGAAAAGCCGCGGAAAGTCGATTGCACGACCATCGCTG
CCGCAGCAGCATCAGCCGAGTCGTACACAGAACCTGGGGAATGCAGTACCTCACTTGTGATATCGTCATGCTTGCTCTGATGGATGAGATAATGGCGATA
AGCGCGCTGAATGCGACATGCTGCATCATGGCGTTGCTCAACGACTTGTTTCCAATGGTGGAGAGCGAACGAAAGATGATGTTTTTCGCACGAGAGAAGA
ATGCGTAAACACGCTTCGTGACGTTGCTGTCGTCGTCGATTCTGCAGTTGAACCTCGTGTAGCTGCACCCTTCGTGCGAGCTCCTCCTCTTGAGCCATCG
CCAATCGATTCCTATTTTGCTCTCGACGTTCCTGAGCTCGCCATTCACATGCAAAATGGTCTTCCTGCTCCATTTCCAGTCGGTCACGCATGATAGTTCG
CTGCAAAGCAAGCGTCCATGCCTTCACGAACGCGTCTTCCTGTACCATGCCGTCTCGCTCTTGCTGCCGTTGTCGCTCGTCCTCCAGAGCGCGAACTTGA
GCCATTACTCGCCTTTGCGAGAGCTCTTCGCTGCGCATCGCGGTCGCTTCACGTAGCTCTCGCTTTCGGGTGTCGGACTCGCGCTTCTGGATCTCCACCA
TTTTCGCTTCGTGATTTGCTATCATTTGGAACAACACGGCGTAGAACCGGCGGCGAAGGACGCATTTCTCCTCCATTAATCGCTCTTTCCGTTGCATTTC
GGCCTCCAAACGGATCAATTTCCGAGTGTGCTTTTCTTCCAGCGTCATGGCGTTAAGCTCGCGCTGCTGCGCTTCATGCTGTGCTTTCAGATATACGCGG
ACCAATCGAGATGTGAGCTCTTCACGCGCCATATAGCTGCATTCCTGGATTTGCGCCACCGCCGCCATCCATTTCCGCGTAGTGAGCTCCTCGAGTTGCA
TCACCCGAAGTTCATTGGCTTCTCGCTGCTTGATGGCGTGTTCCTGTGCCTCATGCTCTCGTAGCGCCCACTGCTGCTCGAGCTGCTCCATGTGGAGGGC
AAGTTGCTGCTGTTGTCGCTGGTAGTTTTCCTGGACTTTACTCAGCACGCGCTGCCGCTCGTCGTATCGGTCTTGGATCCATTGTAGCTGCGTTTGGTCC
ACCACAGGACTTGGTGACTTGGTGTCTAGTGATGCCGCTGGTTGGTGTTGCTCCGGTGTAGTTACTACCTCGTTCACCTGCTCTTGTATTGCTGACTCGG
TGTTTGTTGCCACAATATCTTCCTTCGCTATTGTCGTTGTAGTAGCAGCTGATTGATCACGCAGCGTCGAGCCCGCAGATGCTGCAGAT