Description :
From Genome Similarity Track
Location :
scaffold_3:405223- 406595
Transcript NameFunction/comments
g6185.t1 hypothetical protein PHYSODRAFT_495899

Sequence
1372 bases(100 bases per row)
ATGAGCTACAACAACCGGCGAGGAGGATTCGGAGGCCGCAGTCGCGGGCGCGGCAATCGCGGCGGGCGGGGCGGCTATAGCGGCGGTGGACGCGGGGGAT
ACGGAGGCGGCGTGGGCAACGAGGTGTGCAGGCGCTTCATGGATGGTGGCAAGTGCGAGTTCGAGCAGACGTCGGGCGGCCGGCCGTGCCGCTACCCACA
CTTTGTGCGCACCATCGGCGAGACGCGCGGTCACAGCGGAGCCATCAAGGATGTGGCCATGTGGCCCGACCGGGAGCAGCTATTCACGTGCGCGGCGGAC
GCCAGCATCAAGCTCTGGAACTGCGCCACCTGGCAGGAGGTCACCACCATCAACGTGCAGGACGCGCTGCCTCCGTCTGCCAACGGCAATGGCAGCGGAG
GCCGAGGAGGCAACAGAGATAAGACACCGCACACGGAGGGGGTCGTGGCCCTCGTGATCTGCGGGCCCTTCCTGTTCGCAGGCTTCGAAGGCCGCTTCCC
ACCCAACCCCAAGGTGTCGGTTGGAATGGTGCGAGGGTGGAACCTCGAGAACGCTCAGGCGCCGCCCTTCGAGTTCGCAGTGTCCGAGACGATGCCATTT
GCTCACACGATGAACGTGCAGGCGCTGGCGGTGGCCACGGACCCCACGGGCAACGCCACGCTCTTCAGCGGCAGTGCAGACGGATGCATCCGTTACTGGC
AATTGGACACAGCCAGCAATCAGTTCAAGTGCCGCGGAGTGATGGAAGGACATGTGCGCGGAGTCACGAGACTCAAGACTTTTGCGGTGGGCGGCGCGCC
GATCCTCGCCTCGGCGAGTGTGGACTCGACGATCCGGCTCTGGGATTTGGCCACGTACCAGTGTGTTAAGGTGCTATCGGCCGAGGAAAATGGCCATACG
GATGCCGTCATGGACCTGGAATTCTGGGTGAATGGGAACGAGACGTTCCTTATCAGTGGCGGCTTGGACTGCGAGATTATTGTGTGGGGCCTCACGCCGC
CCTTCCAGCAGCTTTTCAAGGAGACGCAAGACTCGCAGGTCACCGCTCTATGCGGCACGCAAGACGCCGCACAGTCTCCCATTCTGCTAATTGGCATGGC
GGTAAGTTCGTGTGTTTTGAAGTTTTTGCTGGAACTGTAAGCCTGATCTTGTAATTTTTGCTGCTGTGTCAGGATGGCACGATCTCAGTGAAGGAGTTGC
CGACATTCGCGTATAAGACCACACTGGGTGCCAATGTCAACCATGGGCATCAGGATGCCGTACGACGTATCACTATAGGCCCAAGCAACACCTTCTTCTC
CGCAGGCAACGACCGCAAGATGATTGCTTGGCAGATCACGGGCGACGTCGCCTCTATCCAGTCCAAGTAAAC