Description :
From Genome Similarity Track
Location :
Scaffold_80:40518- 44572
Sequence
4054 bases(100 bases per row)
TCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACTTAAAGGACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGAT
CCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCA
TCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGG
AAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTTGCTGA
TCCCGCTACACCACAATGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGG
AAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAGCTCTGTCGACGGAAGAGA
GGTGGATCCGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACA
AAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACAAGAA
AGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCT
CGAGTTTGTGTATCGCCACCAAGCTCTACGCGATTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCG
GTGGGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTCTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAG
AGGATATCTTCGAGCTAGACCTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGTACTATGGA
TCCAGTGTCGTCACCGAGGATCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGATACGTCGTCCGAACCACGACGCATGACT
TTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGATCCGAGGACAGGAAGCCCCTGTGAACGCGAAGGCTCAGGACCCAGTACGCCCTACGC
GTGATCTGACACAATCCAGCCAGGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGGTTATCGTCAGATCGGGCTCAAGGTAACCGCCTCACGGATCCGGT
CTCGCCAGTGGAACAGACGGCCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAG
GGTATGAGAGCGCCCGTGCCACAAGTGCAAATGCTTCACGAACATGGAGCACGAGACGTGGAGATGGAGTCAGTGGAGGGAGACAACTCCCATGATGAAT
TCGACCCAGATGATCTGGAGGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGAGTACGGAT
CTCAGCCATATCGGACCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTTAAGTCGGCCCTCATGAGAGAT
CAAGCGTCGGATGCTGAGAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATCCACCAGGAACAAGT
GGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCC
GCTGGAATACCTACATCGACTGAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTC
ATCGAGACGTTGGGAGATGTGGATCTGGCCGACAGGCTGACCCTGCTACGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCG
CGAAACACCGCCAGAAGAAGGCGGCGGTCGGGTCCGGCAAGTATCGCCAAAAGGCCCTGACGCCCACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGC
GCCCGACTCAGGAACTGAGTCAGGATCCGACGGCTCGGACTCCGACCCTGAAGATTACCGTCGAGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAG
ACAGGAGACAACTCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCGC
AGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGT
GTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGG
ATGTTGCCGGAAGTGGCAGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGT
GAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGTTGCCAGGGTCTCTAGTTTGCGC
CAAGTGGACGAGTTTTCCAGATCCAAAGTCTCTTCAACCCTGGATCTACAAAGAGGAGAGGCACGTGGTTACTGGGAGAAACGCCAACATGGTCGATGGT
TCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCTGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACAGGGGAGTC
CCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTTCTAGATAGT
GGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCG
TATACCGTACAAACGGGAGAACGCGAATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTGACATTTAGGTCGGGGATCTCGCTGGTCAAGATGC
CATCCTTGGGATGGATTTCATGGTACCAGCCGGAGTGAGGTTGTATCTGGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGA
CGGCGGCCTTTGTATGGAGCGAAGATGAGGATCATAAGGGCGGATAAGACCACCTGGATCGAGCCCGGGGAAACTTGGGAGCTGTCAGACCGGTTAAAGT
GGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTACCTACCGTAATCCAAGGACCAGGTCGATCGCAATACCTCCAGGTCACGAACGT
CAGCGACAAGAGACTATTACTGGACCATTATGAGGAGATCGGACGATGGTTGGCGAAGGACGGTATCCCTAGGCGACCGGGATATGTGTCAGTGGGATCC
CGCCGCTACAAAGAATGGCAGAATCTGGTGTACGAGGCGACTACCGAGATCGAATCTCTCGGAGAGGTGGAGCTCCCGGCGGAGCCAACTGGCCCCTTGG
TGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGAGATCGACGGG