Description :
From Genome Similarity Track
Location :
Scaffold_22:40507- 42139
Transcript NameFunction/comments
Aphas_H257_08926Voltage-gated Ion Channel (VIC) Superfamily

Sequence
1632 bases(100 bases per row)
GTTGTGGTACGCCAGACGAAACGTGAGGACGATGTCCAGACCGAACAACACGTCCACAAACGTGTCCAAGTACCGCCCCTCTGCCACCGGCGCAGCTTCA
AACCCAATGCGATACGGTACCATGAAGGACGAATACACGATCGCCGTCGCCACTGTCATCTGCCAATTCACGACGAAAATATCGTGTGGGTGTAGCATCC
CATGAAAGTGCGCCACCTACCCCAACAGATAGTATAAGGGTGCGTCTGGTAACCGGAAATATTGCACTATTCAGGCTCAAAACGCGATTTTGGGGCCGAA
TTCAACAAATCTGATCAAAATTGAAACATGCCTTGCTGGAAGTGGTTTAACCCAAATCCAATAAATATTTCCACGTGGGGTTTACTCGTTGAAGAGGTCC
AAAACTCTATATTACAAAATGGACCTTTTACCTCCATTTTGAAAATGGCATTTTGGGTTAATCCCATTTTCCAAGAAAATGGAATAATATTTTTGAAATG
TTACCACACGCACCCTAAACCGATTCGACACACATTCCCATTTGAAACGCAATGTATTTGAAATAATAGAGTTGGTAATGGTAGGTATTATAAATTTTCA
AGAAAACACTAATATTGTCAAATCCGTTCCAATTTGGCCTTCCGAGTAGAATTGAATGAAGTTGACAAAATGTATGTTAGAATGTCCTAGCCAATCAAAG
TGCACTAAAGAGAGGTTTCAACCACCAATGATCGATTGGCCCAGGCCAAATGTTCAGGTTCAAGTTTGTATATGTAACATACATTAAATAGGTTAAAATC
TAATTCAAATCGATGCTCAAATCCATCAGCTACGATGTCCAAAATTCAACGAAAAGGTCAATATAGGTAGTAGAATATATGCTGCGTGCGCCATAAGGTT
CCGCCATCATCATCGTCGTCGTAATGTGGTAACGCCCGGTACAATGCCCGTATAACGTCATCATGTGACTTATCACTGATACCACTTTCAACAGCATGCA
GAATCCATGTCATAGTATGGAGATATAAGAATACAAGACGCTTGTAACAGCTGAGTACCTTCTTTTCCGGAAGGGACAGGCGATGTCCCACGTTGGTGAT
GGTGGTTGCATTCTGCGGCGCGACGTCCAGCGGACGAATCATACAATTAAGTGACGAAAGGGATGGAGATGCTACATCGTCAGTGTGAGCAGCTATTTCG
ACTTGGATTGGAGGTTTCTTTTCGGTAGTGGTGGAAAGGCATGGGAGTCCCGTGGCTGTCGCTGTCGGTATTACGACGTTCTAAAATCGCACCAATTAAA
CTCGGCAAACGACAGAATTGCCAATAAAAAACACATCGTACTGTTCCCAACTGCAGGTTCGTTCGAATATTGATGGACAGGGGAGGGGGTGGGGGCTGAC
GTAGACCAGCATTGATGAGGGGACCCATAAGTTTGGCCTTGGCCGTCGCCTCGGTCTGAAATGTCTCCAGGGCTTCCGGCCAAGTTTTCCCTAATATTAT
GACGTGTTACAAAAATTGAATTCATCTTTAAAACATCGCTGGGAAATGTATATATTATATATATATGTATGCGACTAGACGATGATGCCATGATGTACCG
ATTGATAGAATCACAGGTCGGGGAAGAAACGC