Description :
From Genome Similarity Track
Location :
Scaffold_97:40504- 43396
Transcript NameFunction/comments
Phyra_83808tyrosine--tRNA ligase, cytoplasmic

Sequence
2892 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTGAGAGCGCTACGCACGTCGCCAACAATAATACTACACATCCAAGACTACACGTTTCATTAAGCTGTTTCGTGCAGAG
CTGGAGGCCACGGTGAATTCGAGCCAAAAGACAGCGCTGGATACTGGATGACAATCCACCAATCTGTTTAAGACCGATCTTGCATCAAAAACGCGGCCTT
CCAGGTCAATTGGTATCCTTCACCAGAGACCTGCACAACACCAAAGCTGCAGCGAACAAATCAGTCAGGCCCAGCCCTCCAGCCTCGCTACAGTCCTGTG
AGCGGCTACACGACGCTTCTCCTCCCCCTGATCACAAGCAACTCGTAGATATATTTTGTATTTATTCTTTTTCTCGTGCAGGTCACGAGGACCCGCCACG
TCGTCTGCGGTTGCTTCCCGAACTCAGCTCGCTTCCACGCTGCGGTCGTTTTGGCCCAGCTTTCTAACGCACACACTACTACACGGGGACACACGAGCCT
GTCGCCGCGCCTACTTGGTTACAGCGATCTTCTTGAGCGTCTCGACGCGAACGGGGCCCGCTCGTGAACGCACAGGGTACCGGTCCATGTACACGACCTC
GCACTTGTTGTTGGTCTTGATGCCCTTGACGATCGTCTCCCACACCTTGTTCTTCTTCATCTGGATGGGGGTCACGGGCTCTTGCACCTCCTCGCCGCTA
GCGTACACGCGCTCGCCGATCTCAGCCTCCGGACTCGGGTCCAGCAGCTCCACCTTGCCCTTGTCGTTGGCGCACAACAGGATGCCGCCCGTGGAGCGCG
TGCGCACGACCTTGACCATCTTGAGGTTGCAGAGCACCACAACCTTGCGGTCCACGAGCTCCTCCTCGGCGAAGAACGGCTGGTGCTCCATGACCATCTC
GAGCTCTTCGCCCTTGCCGATGTCCACCTTCTCGATGTAGTGGCGCTCCGAGTTCGGGTGCGCCTTGACCTCGGTGATCTTGCCTACCCGCAGGTCCAGC
TGGGAAAAGACGATCGGGGAGCTGTACACGTCGGACTTGACCATGGTGGTGGAGGTAGAGAGAGCTTGGCTTGGCCTGGCTACTGCTGGAAAGGGGTTTC
TCCGCTTGGACTGAAGAACCGCTTGCGCACTGGAAGACAACTTGGGAAATGGCACGGTCGAAGCAAGGCGTACGTACCCCCGCTTCGCAAGACAGGATTC
GGCTGGGCCGAGAAGCCCAAGACATGCAGCGAGCCAACTTCAAGCACTGTTTTATTCGTGGGTGGGGGTTTCCACCAATCGCAGCGCCGGGTCCATGGAA
AGGACTCTTTCGCGCGCCGCCATTGGCCGGAAAATGCCGCGGGTGTCCGGGCGCGTGTCTGCCTGCCTCGTTGTTGTTTGTGCCTCTCAGTC