Description :
From Genome Similarity Track
Location :
contig_20:40503- 42054
Transcript NameFunction/comments
g5189.t1hypothetical protein

Sequence
1551 bases(100 bases per row)
TTGTCTCGCCTTCGCACGTTGTCGGGATCGCAGTGTCTCTTCGAGAGTCTCTGCGTCCGGAATTCTTAGCAGTGCTAGTTGGCTGGCTAGATCGCGATCG
TCGAGTGTTTCGATGAAGTGATCGACATGTTCACGGCGGACCTCAATCGATCCATCCTTGATCGAGAGCTGAGCTCGCAAACCAGCGACATTCAGACGGT
GCAGATATTCCAGCGGCGATTCATCCGATCGCTTTCGCGCATGGTAGTATTGTCTCGCGACAGACACGCCACGTCCGCAGTATTGGGTCTGGAAGTTCTT
AGACAAGCTCTTCCAGTTGCCGCGCGTCGTTCGACTCAGCTGTCGGTACCAGTTACGTGCGGGTCCAGTGAGCAGATCTCCAAACACCAGACACTTCTCG
CCATCAGGAGCTTGATCTCGGACAAAGGCAGACTTCAGTTTGCCGAACCAGCTTCTGGCACGATCTTCGTCGTTGTCCTTCCCCGAAAATTCCTTCAGTT
CTGAGATCGCGGAGACTCGGATCCTTGTGGCTGAGAGTGTTCCGCCGCCTGTAGTCCCAGCAGATGCGACTGCGGCACGAGGGGTAGCGTCGACACCCAG
GTCATCCGGATCGTATTCGCTCGGGTGCGAATGGTCCCGGCGATTCGACTCCACGGACTCCATGTCAACGTCTTGAGCTCCAGGTGGCTTGGTTTGGTCG
ACGACTGGCGTGGTCGAGACCGCTTGCTGTTCCTTCAGGAAACGCTCCATTGCTGCATTGAAGAACGATTGCATGCGTTCAGGGGGAGCTTGGGCTGGAT
CGCTCGTCGCGATAACTGTCGGCTTGGTTTCCGATCTCTCCTTTCGCGACTGTAGCATGGCTGCTCCGGCCGGCCCAAGTGTCATCCGCTGCAGCTCGAT
CGAGCTGTCCGATCCCGCTTCGGATGTGGCTGAGGCATATTGCGACGATCCGGTTTGGCTGCGAGTCGGTGCTGGTCTTTCACGTTGAACCGGGACGACA
CTACCGACAAGGGGCGTCAGCTTCGCGAACAGGCTCAGCGTTGATTCCCTGATGATTGGCAATTCCAAGTCGAATAGCTCGTTCGCGTCGAAGGAGCCGA
GCACGATTCCCGCTTCTTTCAGCATGCGCATCAGCAGTTTCACTGCCTCGAGTTGGCTGGTTACTTCCTTCGGTGCCTTCACTGGACCTTGCAGTTCCCC
GATTGGCTTCGGGCGCACGATCTTCATTACAGGGTCTTCGTGCAGGAACTTGTAAAGGTCCTTGTAGAAGAAGGCAGACTCCAGTTGCTCGTCCGTCCAC
GTGTTGCAATCCTCCTGGTCTTCGGCTTCAGACTCCGGTGCCTTCAGCTTCTTGCGTGAGGTCTTCGACTTCTTCTTCTTCGAGGTTGCGTGCGGAACTG
GAGGAGTGGTTTTGGATGAAGGTCCTTCGGTTTTCACCGTCGGACCTTCGTCCGGCGGATCACGATTCGCATCGCGATCCGCGGGGGTCCCCGAGGGGAC
CTGGGGAGGGGTTTGAGGCTTTTCTTCTAGGTCCATCGCTGAACCTTCCTC