Description :
From Genome Similarity Track
Location :
contig_3:405003- 406373
Transcript NameFunction/comments
g839.t1hypothetical protein PPTG_08965

Sequence
1370 bases(100 bases per row)
ATGAGCTACAACAACCGGCGAGGAGGATTCGGAGGCCGCAGTCGCGGGCGCGGCAATCGCGGCGGGCGGGGCGGCTATAGCGGCGGTGGACGCGGGGATA
CGGAGGCGGCGTGGGCAACGAGGTGTGCAGGCGCTTCATGGATGGTGGCAAGTGCGAGTTCGAGCAGACGTCGGGCGGCCGGCCGTGCCGCTACCCACAC
TTTGTGCGCACCATCGGCGAGACGCGCGGTCACAGCGGAGCCATCAAGGATGTGGCCATGTGGCCCGACCGGGAGCAACTATTCACGTGCGCGGCGGACG
CCAGCATCAAGCTCTGGAACTGCGCCACCTGGCAGGAGGTCACCACCATCAACGTGCAGGACGCGCTGCCTCCGTCTGCCAACGGCAATGGCAGCGGAGG
CCGAGGAGGCAACAGAGATAAGACACCGCACACGGAGGGGGTCGTGGCCCTCGTGATCTGCGGGCCCTTCCTGTTCGCAGGCTTCGAAGGCCGCTTCCCA
CCCAACCCCAAGGTGTCGGTTGGAATGGTGCGAGGGTGGAACCTCGAGAATGCTCAGGCGCCGCCCTTCGAGTTCGCAGTGTCCGAGACGATGCCATTTG
CTCACACGATGAACGTGCAGGCGCTGGCGGTGGCCACGGACCCCACGGGCAACGCCACGCTCTTCAGCGGCAGTGCAGACGGATGCATCCGTTACTGGCA
ATTGGACACAGCCAGCAATCAGTTCAAGTGCCGCGGAGTGATGGAAGGACATGTGCGCGGAGTCACGAGACTCAAGACTTTTGCGGTGGGCGGCGCGCCG
ATCCTCGCCTCGGCGAGTGTGGACTCGACGATCCGGCTCTGGGATTTGGCCACGTACCAGTGTGTTAAGGTGCTATCGGCCGAGGAAAATGGCCATACGG
ATGCCGTCATGGACCTGGAATTCTGGGTGAATGGGAACGAGACGTTCCTTATCAGTGGCGGCTTGGACTGCGAGATTATTGTGTGGGGCCTCACGCCGCC
CTTCCAGCAGCTTTTCAAGGAGACGCAAGACTCGCAGGTCACCGCTCTATGCGGCACGCAAGACGCCGCACAGTCTCCCATTCTGCTAATTGGCATGGCG
GTAAGTTCGTGTGTTTTGAAGTTTTTGCTGGAACTGTAAGCCTGATCTTGTAATTTTTGCTGCTGTGTCAGGATGGCACGATCTCAGTGAAGGAGTTGCC
GACATTCGCGTATAAGACCACACTGGGTGCCAATGTCAACCATGGCATCAGGATGCCGTACGACGTATCACTATAGGCCCAAGCAACACCTTCTTCTCCG
CAGGCAACGACCGCAAGATGATTGCTTGGCAGATCACGGGCGACGTCGCCTCTATCCAGTCCAAGTAAAC