Description :
From Genome Similarity Track
Location :
Scaffold_1178:4050- 5518
Transcript NameFunction/comments
Phymu_g12871reverse transcriptase

Sequence
1468 bases(100 bases per row)
CCAGAAGTCCCGATCTCGACTACTGAAGAAGTCAAGATTGAAGATCTGCAGGTCGGCGATCCTGGATCGACCACCCCACAGGAGATCGAAAAACTCCGGC
AGATCATCTGGGAGAAGCGACATCTCCTGATAGGCAAGGGAAACGCACTACCGCCGGCAGCCAGAGGAGTTGTATGTGATATCGATGTCGGAGGTGCGAG
GCCGATCGCACAGAGAGTACGCAAAGTGGCACCGCAATTCCGCGAGAAGGTGTCAGATCTGATCAAGGGACTTTTAGCTGCCAAGATCATTCGACCATCA
ACGTCACCCTGGGCATCCCCgatcgtggtgatcatcaagaagaacggtGTGGATATCAGGCTGTGCATCGATTACAGACTGGTGAACAGCCTCACGAGGC
TCATGATCTACCCAATGCCCTTGATCAACGATCTGCTCGAGGATCTAGACAAAGTTTTGTGGTATTGCTCACTGGATATGGCAAGCGGATTCTGGGTGGT
GTCGATGACCGATCGAGCTCGCGCGATCTCGGCGTTCATCANTTGGACTGAAGAACGCTCCCCAGATCTACCAACGTCTTGTCGACAACGCCTTGTATGG
ATTCCTGAAGATCTCGCGATCAGGTGATTCGGAAGGCTTGATCGATGTGTTCGAGTCGGGGATCCCGGAAGATCCTGGTCGACCATCGGTGTTGGGCCGT
AGATCATACATCGACGATATCCTGATCACCGCTGGATCATGGGATCAGATGTGCCAGAGAGTGGAAGATCTACTAAACGCCTGTGACGAGTGGAATCTGT
CGATCAGCGTGGCGAAAAGCTTGAACAAGGTGGAATACCTCGGACATCAGGTGTCGATCGACGGTCTGGAAGCCAATCCGAAAGATCTGAAATCCTTGAC
CGACCTACCGTTTCCCGGATCCCTTCGATCGATGCAATCGTTCTTGGGTAGTCTCAATTACTACAGTCGATTCATAGAGGATTACGCAGTCTATGCCTCG
GTACTGTATGAACTACGTGAAGTGGAGTTCGCAGAACTGCGGAAAAGACCCGAGTTACGCAAGATCATGGATCGGATGGACGTGATTACACAGGATCCCG
ATCGTTTAGAGTGCGAAATTACCAGATCGCCGACAGGACAGGAACCGGAGCCCGATCTAGTCCCGAAACCGGACTTGGGGGCGATCGATCTCGGATCTAA
CATTGGAGGCGTGGAGGCACGATGGATCAAGGCCCACCAGGCCTTCGGAGCCTTGAAACTGAAGATCTCGTCAACACCGATCTTACGTCATTTCGATGTG
GCGAAACCTCCGGTGGTGATCGTGTATGCCAGCGATTGGGCGATTTCCGCCTCTCTTGCACAAGAACACGACGGGATCTACCACCCGATAGCTTTCGCTA
GTCGCACGTTGAAGGTGAACGAGTTGAATTACAACGTGGCAGAGAAAGAGGTACTAGCTTTGCTGCGG