Description :
From Genome Similarity Track
Location :
Scaffold_200:40488- 46267
Transcript NameFunction/comments
Phyin_T30-4PITG_21017Hydrocephalus-inducing protein%2C putative

Sequence
5779 bases(100 bases per row)
CCGGTCTCTGAATGCTTTCAACGCGGAGGATATGCTCCAATTGTCGGTTCGTGTTCCAGGGCAACCTATTGATGAATACTTGGCGGAAAATGGGTTGGCC
CCGATGAGTTCGTCAGACGTTGTGTCGACAGGTGGTACTGGCCAACCTAGTGAGCTACACAATCCCACTGATTCTTCTTCACACTTGGCAGAGAACGAGG
GCATTGGGTCCAAAGAACAAAGGGATATGACCTTGAAGAGTATTGCAGATTTTAATCCTGCACCAAGAAAAGGTATTGACTACATAATGGTAGGCCCACC
ACGATGCGGGAAGTCAACACAGGCGCGTCTTCTTGCAGAGAAGGAATCGTTGGCTATCTGGACGATTGATGGCGCAATTAACTCGATATGCGCCGCAAAG
GGGCCGCTAGCGACAGCCGCACGTAAAGCGCTTGTGAACAACAAAGGCGAAAGTGAAATTTTGCCCTCAGAAGTTCCAGAATCAGTCGAAGATAGCACAC
GAGAGGTAGAATCCATCGCTGACAGACTCGCTCATTTATTAAACCAGATTGTTTTGTGGAGACTGGCACAACCAGATCTCAAAAGCGGCAGCGTTTTGGA
CGGTTTTGAAAATTCATTTCTAAGCGTTGAAGAAACGCTTAAATGCTGCTCGAGGGCGTTTGTAACTGCGCGGATCATCGTACTGGGATTCGATGAAGAC
AGCTACGAGTCGATGAGTACGGTGCTTGAAAGTCAAACCAGTAGACCCGGAAGTGGCGGTTTTGTTTCGCCATCTCCTTCGCGTGATCGCTTAAATCCGG
TCGGCTCAGGAAACGTAGGGAATAATGATACAGCTGGAGTTGATGGAGAGGCAACCGATCGTAGCGTGGAAGGAGAAGAAGTCCAACAGTCTGCTCCTGA
TACAAATGTTGCTCTAGAGGCAGAAACAAAGGCCCTGTCAGCTTCTCCATCGCGACAATCAATAAATTTGGAAGCAAACGTACGCGAAGATGTGTCGGCT
GGGACAGATGCTAGCGAGGAGAACACTGTAAGTGACAAGGCCAACGATCTGACACATTCACTGTCTGCACAAGAACTCAAGCCTGCAACCTTTGTGGAGT
ATTCACAAATGCTAAAAGCCATGAAGCGTCAATTGGCTTTGATTATAGTTCGAGAGGAACTGGAAATGGAAAGCTCTACCCCACTGAGCTCTGAGGCGTG
TGATAATGATGATGCCATATGGTCACAAGTGAAGGATCGAGCTACACCCGACCGTTTCCTTCTGGACATTCCAATCGTAGATGCTGGCCCACCGCTTCTT
ATCCACAGTGCAATCTTCTCAGCTGTTGAAAAGTTTGTCCGCGAGTTGGAAACCAGCCACAAACCAATCCCCTCTCCTGCCAAGTTTCAACTTGTTCGGA
GGCCTCTAGAGAGGTTTCCTCGAAAAAGAGTCGCTCGTTTTTCATTGCGGTCGCCAGCAATGCAATCTTCAGGTGCACATGAAGCCAGCAGCAGTGAGAA
GAGCCTCCATACCAGTGGATCGCGCTCTCAAATACCAAGCAAACACTCTTCGCGTCCTCAAACTGCTGGTAAAACGCCGAGTCACGTACAGGTCATAGAG
GTTGGAGAACACTCGGAGAGACCAACTGATAGCATGGATACCCACCAATCCTCTGAAGCCTTGAGCACTGGACTGCAACGTCCTAAGACGCGAGTTTGCC
CTCCCGCTTGCCGCTGGGTAATTGCTCCTCACTCGAGAGTTAATGTGCTGGTTCAGTTCACTTCACCTGATATTGGCAACTTCGACTGCACTTTGGGCTT
TGAAATTGTAGGTGTCCAGCGTGAATTTACTTTGTTTGGTCGTGGAGTCTGTGGTGTGCCGACCATAAACAATGACCCGAGGAATGTGTTCATGCACCGC
GTCAAAAGCCGCCCAGAAGGTGCATTTGTTCAGAAGAAATTTGTGATCTCAAGGAACCAGTTCGAGTTCGGTCCGCTTATTATCACTAACCAGCAAGCGA
AAGCACCGCAGACCGAGCGAGAGTTCATCGAGTGGCAGAAAACGAGTCCAAACAATGTCGAAGTGTTCCGGATGTCCAATAGCAGCAAGTTTCCGATTCA
ACTGGAGTTTGGGATGGAAAAGCAAGGAGATGATACATTTGTTGTGTTCCCTGCTGCAGTTGAGATCAATGAGGGCGACACGAGAGAAGTCAAAGTGTGG
GCAAACCCGTTGGAGGTTGGGCTTCATGAGAACGCCTTAATTTGCTGTATTGGCGACAACCCGGAGCCTGTGAAATTCCAGATCAGTTGCTACGGATGTA
AACCAGAGTTGAAGCTGCGAGGACCATGGGAACAACCAGCTGCGGCGAGTACATCAGAGCGGGAGGACCATCGACAGGCTGACGACGCAACAACCAGTAA
GACTCCCAGGTCTTCTAGGTCCGATAACCCTGGCAGTGCCCCTGCCACTTCTAGACCTAGTGCATCTCTAGTGGAACAACCTTCTGTTCCATCCCACTTA
CACAAACAACCAGTTTTGGATTTCGAGCAGCTCTTGCTGAAGCGACAAGAGGAAAAGGTATTTTACATCGAGAATGTGGCGCCTGTTGCGGTCTTGTGGC
GTTTACTATGCGATAACTTACCAGAAGATTTTCGGATTTTCCCAGTCGAAGGAACTGTGAAACCTCTGGAGAAAATCCCAGTAGTGGTTGTGTTCTCGGC
AATGACAGAAGCTGTTCACGAGCTTCTGCTGCGAATTGAATTCTCGGATGCTGAGAGCGCTCTTCAAATGAATGACCGGAATCGGACGGTTGAGTTAACA
TTGCGAGGAGAAGCTTACAAGATCGATGTGAGTTCTTTTGACAATGAAACTAGAGAAGATCCTGGCCAAGCAACATCTAGAGCTGCAGGAAACACGGTGA
GCGGTGACGGGATTCTGGACTTTGGTCTGGTTCGAGTTGGAGAGAAGCACTTTAGAGTATTCAACATTCGCAATAGAGGCAAATACAGCATCAAGTATAT
CATCGGCATTAGAAATGCAGTCACTCGTGAGTACTTCACGATCGAGCCAAGCGAAATGGTGCTGGAGCCTGGGCAGTCTTCATCAGTGAATGTCACGTTT
GCATCCAAGAGCGAAGTCACGCTCCGTGACTGTAAGGATATCAAGTGCACTATTATTGAAATGCTGTCAGGGGAGGCGTGTCGTGAGTTCTACGTCCACG
CTAGTGCCCGATCGGTCCTCAGTAAGTTTCGACTCCGGCCAAACCATGGAATTAACTTTGGTCCTCACAAGTACAGTGAACAAGCACAAACCAAGAGGAT
TGAAATACGAAACGATGGCGAATTCCAGTTTAAATTCCGCGTCCAAGCTTCTAGACCGGTGACTGAAAGAGAGGAAACGGAGCCTTTGACGTTAGATACA
CCACTGTCTCCAGCCACATTCTCCATAGGCCACTTTGCGCTTTCCCCAGATTGCGGCACTATCGACCCTGGAGCTACGATGCGATTGGATGTCGCATTCC
AGCCGAAGGAGTGCGCTGTGTACAGCGAGACACTTCAGATTGAGATTTCTGGTCGCAATACGGAGGATGCGACTGAGACGGACATGCTGCTGTACGAACT
AATCGGTGAAAGTTGCTACCCAGGCATTAACACGACGGATTACGAGAGTATCTTCGAGGAACAAACGGTAATTTGCTCATTAGGAGTCGAGTCGGTTACG
CCAATGTCATCACTTCGCAGTTCGTCTTATCATGGGAATGCCCAAGCGGTCACATTCGCAGAAAAGGAAAAGATTTTCTCGTTTGGTCCGTTGATTGCAG
CGGCAAATTGGAAAGGAACGGTGGAGCGCTTCAAGATCTCGAATCCGATGAAAGTGAGCAGCACGGTGCAGTTTTCTATAACAAACGGTAGCACTGGAAG
TACCGAGTCCGAAAATGGCTCTCCAGCGTTCATTGTACAGCCAGCTGTATGGGAGATTCCTCCCCTTGAGCATCGTTTCGTAAGCGTTTACTTCCGCCCA
GCGACCATTGCCTTGTTCCGGGCCACTTTTAATGCGGTGGTTGATGATAGTCCTCCTCAAAGCAATGTGGCGGATAAACTTCTCGAGTTCGAGATGCGAG
GGGAAGGAACAATGCCCTGTGTTTTAATTACGGAGCCGACAGCTCGAGACTCAAGTGGTACCATGATGTTAGATTTTGGTCGAGTTCGGACTTCAAAAAC
CAAGGATATGCGTTTAGCACTACGCAACGATGGGATTCTACCAGCAACCGTATTATTTTCTAGTCAATCGAACCCTAATTTCCTGTTCGCAATGGGCAAT
GGATCGGTAATGGTGGCCCCAAAAGCTACTGAGACGCTGACCTTGCAGTTCCGACCCCAGAAGGTTCATGACGAGCCAGTCACATCACAACTCAAAATTG
CAGTGCAGAATAATCCTTTTGAAGAGACGGCGGTCACGCTCTTTGGATGCGGATATCAAGAAGATTTGGTATTTGAAGACTTGCCTTGTGGGTACGATGA
TGAACTTCACTTTGATGATATTCGGTTACCAGACGTGAGTGAGACGAAGAACGATGGGTTTCTAATTTTTAAGAGCACGAAGGTGTTCTCGCTACGCAAT
CAATCATCTGATATCATGCGTTTCGAGTGGCCAAAAGCTGATCCATTCCACTTCTCCCCGTGTGTCGGTCATCTCATGCCAAATGCTTACAAGCTGATTA
GATCCACATTTGAACCGGCACAGGATGGAGATAAAACGGCCATATATCAGGCTCATCGCATCGCTTTGCAGTCTCAGCGAATCTCGTATAAAAGCAGCTC
AGTCAATCGGAGTGACATAAATGTCTGGGATGACTCTTTTCAGACGGTTTCATTTGGCGGACAAGCAGGAGCTGGAGGTGTTGCAAAGCAAACACTTGTG
GAGCCTGAATTTGAAGCAATTGGGCCTCCCTCGACCATCGTATTAAGTTGTTTTGCTGCAGCTGATACCCTATCTTTCGAGTGTGATAAAACGTCTATCA
CATTTCGCAGAACCTTCATGCTACAAGTGTGTACGCACAAAATCACGCTGCAAAACAAGAGCAAAATCCGTTTGGCATACTCGTGCAGATGGGAGGAAGG
ACTTCATGGTCAGTCTGACTTGGGGGGTATTGATGGTGATGTGGACGATAATTGCCCTTTTGACGTGACACCTGCTACTGGGACAATCAACGGGGAAGAA
ACTCAAACGTTTACTATTAAGTTTGCCCCAATGGAAGTGGATGGTTATTTGTACTGCTTGTGCTTCGACATTCCAGACACTCAAAAGGATAAAGTTACGG
TGCTTCGAGTGGAAGTTCGTGGTGAGTCTCTCCGACCTGCTTGCCATTTCGATGTAGAAAGGAGTGACTATGCGCAATGGAGAGCTCCGAACCTCCCAGG
CCCTCATGGTGAGCTGGGGCCGTTAGATCCTTCGATCAGAATCATCGAAATGGCGTCTCTTGGCGTTCGAGTCCGCAACACACGGCGGTTTTACGTGGTT
AACCCAACGAACGTGTCGTATGAGTTTTCGTGGATCCCGCAAGGGAACAACAACCCGTGCTTTCGGTGCGCGACACCGAAGGGTCTGATGCTTGCTGGTA
AACGATGTGAGATGATTTTTGAATTCACTCCACAGCAACTAGAACTCCAGGAAATGTTCTGGTACTTCAAAATTCCGCATTTCCAGGTTAGTCAGCTTTT
CGTGTTTGTGGGTACGACGACGGAGCCTCGAGTCGCGTTGGATCGTGCAAGTGTCAACTTTAACACACTGATGATCGGA