Description :
From Genome Similarity Track
Location :
Scaffold_71:40473- 42016
Transcript NameFunction/comments
Phyke_g3279hypothetical protein PHYSODRAFT_522664

Sequence
1543 bases(100 bases per row)
CTTGCTTATCTTTTTCACCAATGCAGGATGTCTGAAAAATATTTCTCCGCGAGTTGCAGGTAGTACGGGAGAGAATCGTTTACACTGACCTGCTGTACGA
CATCATCACCCACAGACGCTACCTTGGTGATCGAGTTGACCCACTCCTTCGTGTCGATGTCTTGAGGCGCACACAACTCTTCGTAATTGTTTTGTTGGTG
CCACGTATTGAAAGACCACAAACGGACAACATCAAATGCTTCTGTAGGCAGAGTGGTCTTGTTACCAGACAGCACGCGATATAGATATTCATCCGAGGTC
CAAGGGAGCATGACATGTTCCAAGCCACAATGTTTGTCGACCATGCTCTCACTACCCTTCGCGGCACTGCTATGATCCAGATTCAGCTCATTGAGCTCAG
GGAACTCGATAGAACTTGGGATAGGCATACCCACGACCCACGTCGTGTTCCTGTCCATCCACTCTTGAGCCGAAATACTGCGCAGCACGGCATTGTCGTC
ATCTGTCCAGCACAAGAAAAGCATGCCAAGTGCTCGCAAAAATACAGCGAGCTGCAGCCAGTCAGGGTGGCCATCTTTCTTCACAGCGTCGGCCGTAGCC
AGCATGTACTTGATCACCCAACTATCTGCGCGCTCGGTCTCACCCGTCAGCTCCATCACGCACTTGCAGGCTTCTGCTACGGACATCTCCGCATGTTCCA
AATCTCCATACTTGGCCACTTGCTTTTTTACAAAAGCTCTCGTTTGATACTTGCGCATGATCTTGACGAAAAGTGGACGTGGGTCCTCCTTGTTGCACAC
CAACGACATGATCTCTCCTCCATCCCAAGGCACCGGGTAGTCTGAAACCTCAACACGTTTCTCCAATGGATCAATGCACAGATAGCTGCCATGGAAGCTT
CGTAGAGCGATACCTCCGACATTTTGCATGGCATTTTCCGCATGATGTGGGACTGCCTGGAAGGTCTCCCAGGTAGAATTGAGAGGACGGTCAGCTAGAA
TTGTACCGTCCTtctccacacacaggaaTTTGCCATGCACACTACGTAAAAACACCTCTCCACATGGTCCCAGTAGGGTCTGCCACATGCAGTTATTGTG
ACTACTACTGACTTCAATAGCTCCATCCTCCTCAGCGACTAGACAAGAGCCGTCAGAGGTTTGCAGAGCCATCATACAAAACCAGGTAGTCTCGGTAGGG
CGGATAGGGTAGAACGTGGTAGGGTGAAACATCGACACCATAGGCACTTTACGAAGGCATTCGTTGCCATTGTAAAGCACAAGAATTTTGGCGTCGGGTT
TCTCCATGAACCCCCACCCTTGGTAGAGTCCTACCAATCTACCATGGCGTTTCGagtcttcttcagcttctaAATGTAGTTCGCGAACTTGAAACTCTTC
TAGAGTGTTTAAAGTTGCCAGGTAAAGTACACGAGCCAACCCCAGCCCTCGAAATTCTGTGTTCACCACGACAGACTTGACATGAGCTGTTGCATTCTTT
TCCAAAGTGAAAATGAGTTTCCCCACAGCGCCACGTTGTGTTG