Description :
From Genome Similarity Track
Location :
Scaffold_119:4047- 9261
Sequence
5214 bases(100 bases per row)
CTTCATCTGACGCTAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGGATGG
AACACCCCGTGTTCGCGAATTTGCCCCCGGCGCAGCAGGACGCGCTTACTAAGCTTATGCCCTTGCTTGGCCCGGAGCGCGTGGCTCATCTTGCATCGCA
AGGTCCAGAGGCGGTCACTGCCAGGCTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCATGTCCAAGAGAAGATGAGCGCCGCAACGGCGGCG
GCGTCGATGACGCATGAAGAGTCTATGAGACTGAAACCGCTCATGGTAAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTCTCTGGACCC
GTGAGGTCGAGATGGCCATGGGATCGGCCCTGCTCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTTTCTCCAGGCTTGGCGGTCGCGCTCGCGAATGGGC
ACTAACGTGCGGCACGTCTGTTGACGCTGCATTTCCCACTTGGGATCAGCTGAAGCAACAGCTTTCGCGCGTGTTCGCGCCGCCTAATCAGGCGTACCGT
ATCCGGTCAAAGTTCCTTGCTACCCGCCAGGGTAAGACGGATTTATTGGACTATGTCCAAGAGTTGAGAACTCTTATCGCCGGAATGGCGGCGGACCCTC
TTCCGGAACTGGTCAGCGTGACCGTGTTCATGGAGGGACTTCGTGTGAGCGCAGCTCGAACGGAAGTGTTCTGTGTACACCCTAACTCTTTTGAAGAGGC
GGTGGATGTGGCATTGAATGCCGAGCACAACTTCAGGTCGGCGCGACCTGGTTGGAGCGCTGGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGGAC
CTCAGCTATGCTGAAGATGAAGAAGCGGAGCTTCTTGCTGCGGAGCAGCGCGCCGGCATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGGG
CCTATTGCCCTCTGCGTAAGAAGCGCGAGGCTCCGGCGAGTCAACCCTCCGGGTCATCGCCGGGAAACGGCAACTCCCAGTAGGCGCGGGGCGGCCTACT
GGGGAAGAACTGAGTTCTGTTGTGCCCCGAAGAGGTAGAGGGCAACGGGGCTCAGCCCCGAAGAGAGCTGAGCTCTCTTACGAGAAGAGTGTGTGCAAGC
CGGGCTTGCTGGTCGTTCAAGCGAACGTGAAGGGCTTTGCAAAGCCATGAAGAGTCTTGATTGACTCGGGAGCCTCGAACAACTACGCCCGTCGCTCCAC
CCTGGAAGGGAGTCAGCGGTATGCTGAGGCACTGGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAG
GTCTCTGTCGACCTTGGAGTGAAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTTAGATCTGGATGCGAGGTATGACCTCATCCTTGGCATGG
CATGGCTGGAACGCCATGAGCCATGGATCGACTGGAAGTCGAAAACGCTAGGTGCGTCGCACCCTGCTCCTAGCGGAGCTTTGGTGGAGTCATGAACCCA
CCTCTGCTAGGAAGCAGAAGCGCTTTTTGGCGCGAGCACGAGGCCGAGGCGGCCGTAGTGCTGGACATTGGTATGTCCGAAATTGTGAGCAACGAGGTTG
CTGTTTGCCTGAGGGCGTACGTGGTGCGGCACGTTATTCGCTGAGCGGTGCAGGTCAGGTCGATGACCCAACTGCTGGGTCCTGGTGAGGACGAGCGCGG
AGTGGCGCGTAATCCCACTGAGTGGTACGCATCTGGTCATTGACCTACCGCTGCGTGACCCGAGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGT
GGCCCAGGAGATGCAGGTGAAGTAACACCTAGTTCACTGTGTGAAGGTCAAGAACCTCTTGGCTTTCAGCCGAGTGTCTTGCGAGACACTGTATCCTCTT
CGAGGAGTGATGGTGCTGCTGCACCCGGTGGTGGTGATGGAGATGTCGCCACACCGCCCTCATCCGGCCGGGCCCGGTCGCGGAGGGAGAGGAGAAGAAG
ACGCAGGGCGTCTGTGACGCCTTCGACGTCGGACGATGTGTCCAACGTGTCGAGCGGTGATGCTCCACGTGATTGCTGTGAACAGCTGTATACACTCGTT
AACGGAGTGACGGGGGAGGTAGAAGGCGATATCAGCCTTGACACTCTTCCCGCTGCAGATGGTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTTG
GCGAAGTCTTAAAGGCAGGCGAGCTAGCCGAGGTGGTCCTGATGGGACCTGAGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGA
CACCAAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGGTCCTTCGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCG
AAAGACCCACCGACGAGTCTGCCTCCGCATCGAGGCGTGTGTCATGAGATTTACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGC
CGAGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGCGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTG
TGTCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGAATCCTCGCAAGGATGTT
CTGCAGAACAACATGGTAGGCTGTACGTTGTACAGTGCGCTCGACTTGGTCGATGGTTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGGCAG
CGGTGATTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGTTGTT
TAGGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATAGTCGTGCTGAGCACGGAAAGTCAGACGTGGAAAACCACATTGACCCC
TTGCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTAGATAAGTGCGTCTTTGGCGCGGAGGAAATACCTTTCCTCGGGTGCTTCA
TTGGAAAGCGTGGCTTAAGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAGGACTTACGCAAGTGGCTAGGCTT
AGCCAATTACTTGCACAAGTACAGCGCGAACTACGCGGAGATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACGTTCCATGGTGCTGGAACGTCGAG
CACGACGGAGCCTTGAGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTA
CGATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAGCGCGTGAGCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAAC
TATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATTTTTACTGATC
ATGCGTCGTTACGCACTGCGAGACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAA
GCCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATA
CGCGGAGCGTATGCACAAGATGTCATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTTAAAGACTCTGACAAGGAATTGTCTGGGCGCTTAC
GCGCGAGGCTGCATCGATACTCGCTCGATGGCGGCCTGCTGTACTACAGCACCGACTCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCT
AAAGTATCTAATCCTCTACGAGGTTCATGATACGCTCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCC
AAGATGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACAAAGTCCGCGCCGAGCACGGCAGCGCCTTTGGCGAGTTTGCCTG
TCCCCAAGGAATGCTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGATAAGGCAGGAAACACGGGTATTGTGGTCTTTGTAGACCGATT
GAGCAAGATGGCTCATTTAGCGGTAGTGCCGGACACCATTGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCT
GAGGCAATTGTCTCGGATCGAGACCCGCGCTTCACCGCGAATTTCTGGACGTCCCTCTTCAGAGTGCTCGGCACTCGTTTGGACATGTCCACAGCGGACC
ATCCGCAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATACCCTCCGAAGCGTATGCGCTGAGGCGCCAAAACGCTGAAGCCAGATGCT
TCCACTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAACGGCTTGGCTAACCCTCGCGTCCCACTGACG
CCGCCACGCAGTGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGTTCGCAAGCAAGTCGATGACTTTGTCT
CTTTGAGACTGAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACACGCAGAAGGAACATGCAGATGCTAAGGGCAGAAGCAATGTTGA
GAGGTTTGAGGTCGGAGACCAAGTTTTATTAAACGCTAAAAACTTACCCACTCATGCAGTGTCTGTAGTCTTCAAAACGAAGTTAAGACCTCGGTTCATA
GGACCGTTTAAGGTCGTGACCAGGAAGGGCCTAGCGTATACGCTCAACCTTCCGAAGAAGATGCGCACGCATCCGGTCTTCTATGTTGGCTTGCTTAAGC
CATATCAAGACCCT