Description :
From Genome Similarity Track
Location :
Scaffold_7:404686- 412685
Transcript NameFunction/comments
Physo_337778ATP-binding Cassette (ABC) Superfamily

Sequence
7999 bases(100 bases per row)
CCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCACCGTCACACTTAATAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACCTAAATCCG
CTGTGGTCTCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGAACGACTCGCAGTACGAGTCCGTTCGTAAGATGGCAGGCATCTTTGGG
GCAGATGCCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGAGGGCTCATCGCCCACGTTC
AAGGGCTGCAGGCCACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTGAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAAAACCTTCA
CTTCTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGGTCGCACT
AAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCTCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCCGGCGAACT
ACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTTCATCCAGGAGATGCGAGTGCTCACTGCCTCTTTGGT
GGGGAACCCCCTGCCTGAACATATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAGCAAACACT
ATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCCGCCACGGTATGACAGAGCAACCCTGCCTCTGGCGGTG
TGCCTAATGGTAACTCCGGCAATGGAGCGATCAACGGGCCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCTACGGCTGTGGCAA
GCTTCGGCACATGAAACGTGCTTGTCCCGCGGGAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGCCGCGCCCC
AGGAACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGACTTCATGAGGGGCGTGCGGGTGGCGCACGCCATGGGGA
CTTAGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGGGAAGGGCAGCGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCCCTTGAGA
ATCTTGATGGACTCTGGGGCGTCCAACAACTTTGCGCGCCGCCAGACTGTCGCACGCAATCGGGACAAGTACGCCGATGCGCTACGAGGCAGCAAAGGCA
ACGGACTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACAGGGACCTCACTGGTAAGTTAGAGGACTTCGACAGCACGGA
GCCGTTCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCGCGGCAAGGCCATC
GGGTCCAGCCATCCCCCACGCTCTGACAGAGCTTTGGTGAGTCATGTTCCCACCTCTGGTAGCAGCTGGGGCGCCCGCGAGGGCCGCCAGGGCGCAGCAG
CGTCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACCAGGTGGG
TAACGTAGGTCTACACGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGCCGCTGGCGTTGGCGTAGGTAACCATGTTCCACGCGCG
GTCACTCAGACCGTAACTGATGAGGAAGGCACTGCAGGCGCTTCTGATGTGGGTAACATAGGCCCACAGGAGGTCACTCAGACCATAACTGATGCGGGAG
CCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTCAAGAA
CAAGGCGGGTAACCAAGTTCCGCTCAAGGACAAGGCGGGTAACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGGCGCCACGAGAC
GAAGATACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCG
TAGAGTGTTATCACATCTTCGACGGCGTGACCGGTCGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCT
TGAGGAGCTCGCCATGGAGGACTACTTGGCCGAGCTAAAGGCCGGGGAGATCGCAGAGTTGGTTCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCG
TCCTCGGCCATTTACCAGGCAGTCCTGGAGGAGTTCCAGAGACAGCGCGCATCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGATCCGGTGTACC
CCTTGGTGAAGGAGTTTGAGGACGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCAC
GAAGTACTGTGTCACGAGGCAATGGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGGGGAGT
CGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCTAACCGAACGGAATGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGCC
TGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACAACATGGCCGGCTGCACGCTGTATAGCGCGCTGGACCTGGTGGACGGATACTACCAGATC
CTGATGCGCGAGAGCGACATCCCACTCACGGCTGTGAGCACGCCGAGCGGTAAGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCCTTCTAACGCCCCGG
CAACGTTCAATCGCTTGGTCACACAACTGTTCCGACCTTTGCGTGCGTTCACACAGTCGTACTTTGACGGCATCTTCGTCCACAGCCGTGCCGAGGCAGG
CCAGACGGCCATGGAGGTGATCTCCAGCACCTTCGACGTGTGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCACAG
CTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAGCAGCGCCGGGGCCCGGGTGGTCCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGTC
GCAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAACTATATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCG
ACTGGCGCTGGGAGCGTCGCCATCAAGATGCTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCCAGTCCTGGTATTGCCGGACGAGACGAAGCCTTT
CAGCGTAGTCTGTGATGCGTCTGACTACGCAATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGCCATCTCGTTCCAGTCCAGGCAG
CTCAAGGCAGCCGAACGGAACTATCCAGTCCACGACAAGGAGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGGGCTCGACGC
CCTTTGTCGTTTATACAGACCACGCGTCCTTGCGGACTGCCGTCAACACACCGCATCTCTCACAGCGGATGGCGCGTTGGCTGTCATTCTTCGCGGAATA
CAACTTCCGTGTCGAGTACAAGCCGGGCAAGTTGAACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACG
ACGGATCTGTATGATCGCATCAGGCTGGGGTACCGAGACGATGCCAGTCTCGGACCTCTTGTGCGGTTCTTGGCCGCTGGCTCCGAAGCCAAGGCCGAGT
GGCTCACGCCCCGACAACGTGCAAGGCTGCACCGCTATGAGTGGGTTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGT
GCCCAACGACTAGGATCTCAAGTACGACATCCTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCG
CAGATGTTTTGGTGGCGTCACATGTACAAGTGGGTCGCCACCTACGTCCGTACGTGCGAGACGTACCAGCGCGTGAGGCCTGCCGGTCACGCCTCGGCAC
CATTGCAGAGCCTGCTGGTCCCAGCGGGCTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTTGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTTGT
TGCCTTCGTGTGCCGTCTGAACAAGATGGTCCACATTGCTCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTGTGTCTTC
CGACACCACGGTTTGCCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCGCCTTCTCGGCCCACGACTGT
CGATGTCGACGGCGGACCACCCGCAGACGGATGGCCAGACGGAGCGCGTCAATCGCGTGCTCGAAGACACGCTCTGCAGTATCGGTGCGGAGATGCCCCG
CTCTTGGGCTGATCGCTTGCCCATGGTTGAGTCCGCACTCAACAATGCGGTACATGCATCGACGGGCTTTACGCCCTTTTACCTGAACGGGTTTCGCCAC
CCTCAGGTGCCACTCACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAACTCTCGGACGTGAGTC
CAGCCACCTTGCGGAAGCAACTGTCCTCGTTTGCCGAAGACAGTCTGAACATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAA
GGAGTACTCTGACCGAAATGGAAGAGGAAACATGAACGTGTTTAAGGTTGGGGATATAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGC
TCGGTCGAGAGCAACAAGCTGAAGCACCGCTTCATTGGACCCTTCACGGTCCTCAGCCGGCATGGCGCGGCGTACACCATAGACTTGCCCAAGTCGATGA
CGACTCACCCGACGTTTTACGTGGGTCGTGTTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAG
CGCAGCTCCTCGGAGCGCGGCGTCGAGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCGCGGCGTACATCGGAGCAGCATACGCAGGGG
CCCCGTACGAGCCCTGGCCAAACTGGGCCTGATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCGCGTGGTCATGAAGCTCGGCCCGAGCTGGTTTCGC
AGGGAGTCGTAAGACGACAGGTCGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATTCTCACGGAGCCGCTCCA
CGGCACCAGGCTAACCAGCACGAGCGGCAGCCTCGCCACCAAGACCGACACCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGACGAATCTC
CTCTTGCTGCAGGGCCACCACCTAACTCGGGGCCCCAGCATACGGCTGCGCCGCCTCAGACTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGCCCTCCT
TGATCGTAATGGGCAGATCCACTACCACGTGGAACGAGTCGTCCGGGAGCGGCGGCTCCATCGCAAGCGCCAGCTGCTCGTGAAGTGGAGGGGTTACCCT
GAGTCGGATAACTCGTGGGAGCCCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGT
CCTTGGCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCTCGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCG
GTCATCTTCGGGCGGAGCATGCGCTAGCTCACGTATTGAGCGAACTCGATGCGGAGCTCGCGGGTCCAGGATAGCGGACAGAGTGCGATCCTCACGGAGC
TCTTTGAACTCTTGGTCGGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCGCTCCAGGTCATGTTGTCATTCGGCTTGACCCAGT
GGAAACCCCACACAGGATGGAGTCCACCCTTGTCCTTCGGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACA
CCGGGCGACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGGA
GCCGAGAGCTTCTCCAACAGCGCTGACGCACCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGG
CAGTCGTGGCAGTCGGCTGCCTGGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTG
GACGGCACCCTCCTCGTCCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCG
GCGGCCTTCGCAGCGGCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTGCCAGCACCTCCTTGGGCTTGGAGCCCGCGTCGCTCGGCGACTTCT
CGGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCGGACTCGGCGTCCTCCGCATCCTTCTCTGACGAGGC
CTTTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAA
CTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGCCTTGCG
CGGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTAACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGGCCGCCTTCGTGGCCTCCAT
CAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCTTGCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGCGCTTTGGA
GGCATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGGGCCGATGCGCCAGAGCTCGCGCCGTTG
TCGATGGATTTCGACTTTGCGAGTGAAATGTGAGTCGCCGGCGTAACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGTAACGGG
GTTACATGGAATAGTGACCCTGTCACTATTCCGGGATGGCTACATCGGTCACTCCCCTGGATAGTGACCCAAGTGGCCTCAGAGCCAACAGATACATTTT
GTATGACACAAACTATAGGGAACTTAAGAATTGTATGCAGGCCAAATCTGTACCAACCTATAAACACATTCAGTCTTAAATCTACCGCTTTTCAAGTCAA
GCCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACA