Description :
From Genome Similarity Track
Location :
Scaffold_12:404607- 406539
Sequence
1932 bases(100 bases per row)
TTCCGTCGCCACTCTGTCTTGTTTGGTTAGAGCTGCCACAGCTCTAGCCCGGCTGTTCGCCTCCAGCTCGCAGTCGATGTACATCGAAGCCTAATTTCCG
TAAGGAACGTGATCTTACCTCAAGACAAGGAAGGAAAGGAATTTCCGAGCCTCTCTCCCACTACACTTGAGACTATTGAGTCTCTCGCGGCTTGTGATGG
CCACTGGCAGCACGACGGCTATCTGCCTCGTGGAAAGTCAGGGAGGAATGGTATTTACGAGCCTCTCTCCCACTTAACCTCAAGACTACTGAGTCTCTCG
TGGCTTGTGATAGCCACTGGCAGGCACAACGGGTCTCCGCCCCGTGACTGCGTCGGCCGTGCTGACCGAAGACATCCAGCCTTCGCGTCAGCAGTTTGAG
TCTGCGCGACTTGACGTCGAGCGAGTTGCTCACGTCTGGGGAGGCCAAGACAGCCTCATGCCTCGAGCTAGTGGCTCTGTGTGCGGAACTATGTTACCCG
CCTTGGTTGCAAAAATATGTTACCCACCTTGGATGTGTGGAACTCTGTTACCCACACCGGAAGCGCATACAGCGACTTCTTTATCAGCTATGGTCTGAGT
GACGTTGCGTGGAACACTGTTACCCACGCTCGGAGCACCGAATGTCGGTATCCTTAAGCAGCTTCGCTGCTTGCGGAACTTGTTATCCGCAATGTGGACC
TATGTTACCCACCTGGTGAATGCCCGTCGGCACCATCACTGTCGAAGCCCATACTGCGCGACGACCTTCGGTGTTGGGATCGGCTGGTGTGGCAGACCCG
CACCCACACCAGACAGAGTTGGTGTCCACCACCCGAGTCAGAGGAGTCCGGGCCCTGGCCTCCGAGGCGCTTGAAGCGACGTCGGTCTGAACAGGGTTCA
GACCCGACTTGCGGCGGCTGACGTGACGTGGCACTTCATTACCCACGTCGTGATGTCTCGCGACATCAGAGGCACTCGAAACCTCGTGTGACACTGGGTT
ACCTACACAGAAAGCATGGCCAATGCCTTCCTCTTCGGTTATAGTCTGGGCGTCTGCGTGAGGTACTGTGTTACCCACACAGGAAGCATGATCAGTGCCT
TCCTCTTCAGTTAAGGTCTGGGCGACCGTGTGGTCCTAAGTTACCCACCTGGTTAGCGCTTAAAGGCATAACCAGTGTCGAAGCCTGTACGGCGCGACGA
CCTTCGGCGCTAGACGCTGCTGGAGTAGCAGGTCCACACGCCGGGCAAAAGACCCATGCCCGTGGCATTGCCGCAGCGGAGCACGGTCTTACTGTACGCA
GAGTTGTCGGCGCGTTGACAGCTCCGTGACATTTCTGCGTCCTGGCGGTCTGTATCAGACGCCCCAGTCATGACGGAGGTGGGAACATGACTCACCAATG
CTCCGACATAGACCTGGACTGGTAGGCCCTTCTCAGCCTTGCCACACTAAAGTCCGGGCTGTGCCTTATGTTCGGCACAGCCATGTTGCTTATGGCGTGA
GCTGCGAGCGACACCGCGGTGCGCGAGTTCATCGAGCCCAAACGTTCAGGTCCGTTGAGGACCATTGGTACTGTCCTCACCGTAGTCCACCAAGGACCAG
CTCACGACAGCCACTCTGACATAGAGTGCAGCCGGGTGTCGCTATGTCAAGCGACGCCCGGCGGCGTATCAACGCCCCAGAACTCATCGAACGTTCAAGG
GGTACCGTACCCCCGTACACCGAGTGTACTACCAGCAGCCCATCACTGCCCTTCACCGGTTTGAGAGAACCACATCTCTCTGGGCTAAGTCACGTGGTGT
GCACAACCTGCACATCCATCACGAAAACTTAGCGGTCTTCAGTAGGACATACCGCCTCTACTGGTGGCCGGGGAGTCTTCGTCCACCTGGCCGTGGCCTG
CGCCACCGGACCTGGGGTCCACGGGCTGTCTT