Description :
From Genome Similarity Track
Location :
Scaffold_287:40446- 42082
Transcript NameFunction/comments
Phyta_totarag6703folate-Biopterin Transporter (FBT) family

Sequence
1636 bases(100 bases per row)
AAAGACCTCGAAGAAGGAGACTATGTCGGCGCGAAGACTCCGGAGCAGAGTGGGTACTCGGATCAAGGTGCTCTCCGTCCTGGTGGCGAACCGGTGATGA
CTAGCAGAGCCAACATCGGACTATTGTACCAGTACGCGGTCGTGGGCTTCATCTCTGGCGTGCTGCCATCCACGATCTACCCGTTCCTCCAGATGTTCCT
GAATTGCAGTGGTGCTCAAGTGGCGACTGCAACGACGTTGGTGTCGCTCCCGTCGAGCTTCAAGGTGTTCTTTGGCATTCTCTCGGACTGCTTCCCCGTG
TTCGGATATCGACGTCGCCCGTACATGGTGATCGGGTGGACCATCTCAGTGGCCATGCTGCTAGTGATGGCCTGCATGCCAATTGGTAATCCGTACTATA
CTGACGCTTCTGACCGATATGTTGATGTCTCGGAGTACACAACCGAGATCGAGGCTCGGATCAACTACGACGCTCCGTCACAAGGCGGGAAGTACGTCAT
GCTCATGTTCTTCACGGCACTTGGCTACGTGCTGTCCGATTCTTGTGCCGACGCCATCATGGCGGGGTTGGCCCAGCAGGAGTCGTTCGCCAGGCGAGGA
AAACTCCAGACGATGACTTACACGGTGCAAACGTTCGTGACGGTGATCAGCTACCTGATTGTCGGCTTCTGCTTCAATGGTGAAGAGTACGGCGGTGACT
TCGACTTCTCCTTGAGTTTCCTCGAACTGATGGGGATTCTCACGGTGCTCACAGCGCCCACGATCCCCATCACGTGGTTCTTCATCAAAGAGGACCGACT
GGCGGTCGCTCCGAATTTCAAGAACTACATGGTGGATTTGTGGCAGCAGATCTGCAAGCGGGCTGTCTTCCAAGTCATCGCAGCCTTGTTCTTCTACAGC
TTGGTGTGCTACATCTCGTACACGGCGTACTCGCCCATTCAGTCGTACATGGTGAAAGTGACACCGATCAACAGCACGCTGGGGGACGCGCTGAGCTACC
TCTTCTACATGTTCGGTATGATGGCTACGTCCAAGTGGGGCTTGCACTGGAATTGGCGCTGGATGATCGTCATCACCGGCGTGATGCTCATCGTTATCGA
CAGCACCTGCAACTTGATCATCGTATGGGACGTGTACCGCAGTCAGTGGTTTTGGCTTGGTCCGCCCATCGTCGCGCAGCTACCCAACGGCATCAGCTTC
ATGATTAGCAGCCTAGTGATCGTGGAGCTCATCGGTGAAGGCAATGAAGGCGCCATGTACGGCCTCATGACCACGATATCAGGTATCGCGTCTCCGTTTG
CGACGTCGCTGACTGTGATCATCGACAACCCGTTTGACATCACCAACGACCGAGTACAGGAGGATGACTACTCGATCCACATGGACATCACCTACACGAT
GATCATCGCGTACGGTGCGATGGTCGTGTCCTGGGTCTTTCTGCTCTTACTACCCAAGCAAAAACGAGAGACCCAGGAACTCCTGCGCACGGGTGGCTCG
AACAAACTGCTGGGTGGACTCACGATACTCTATCTGTCCTTCTCGCTGGTATGGGCTGTGATGGTCAACATCATGGCCATCTTCGATAGCACCTCGTGTC
TTGTCAttgctggtggtgacggATGCTAACCTCGCA