Description :
From Genome Similarity Track
Location :
scaffold_57:40446- 41573
Transcript NameFunction/comments
g2328.t1 pectate lyase
g2329.t1 hypothetical protein PHYSODRAFT_562173

Sequence
1127 bases(100 bases per row)
GATCCCCGAAGGTCGGCGGTGCGAGCAACGCAAACGCCATTGCACACGTCGTCAACAACTACTGGGCGGACAACTCGGGCCACTCGTTCGAGCTTGGGGA
GAACGGCTACGTCCTTGCTGAAGGAAACTACTACCAGGACACGGTAGTGCCGCTGGAGAACGGCAACGAAGGAGCTCTCTACGCTGCCAATGCCTCCACA
GAGTGCAAGAACTACCTGGGCCGCTCTTGCGTAGCGAATGTCCTGGACAAGAGCGGCTCGCTCAAGTCTCGCAACGGGGCGATGGCATTGTCCAAGATGA
AGGGAAACACAGCGATCTCGAAGTTCTCTCCTCGTGCAGCTAAGAAGGTGGCCAAGACGACCAAGAACTTCGGCATTGGCGTGCTGAACTAAGGTGTTGG
GATAATGCTCAACCGATTGGCTGGATGCGCTATGTATTGCCGGTAATGCACCGGCCGCTCAACGTACGGCGCACTGTACGCGAACAAAAATTTTTCGCGT
CGAGATACGGACAGGACCCGCCGAAATTATTCCCAATTTTCTTTAACAACGGCAATGCGATGCTTTTTGAGTTTTTTGTTTTCAGTTTTGAAAGTCGTTG
TCAGTGATAACTTGACATGCATCACCAAGAATTCCCCGCCGGGGATTGAAAGGCATTGAAATTCAATGAATGGTAAAGAAGCCTGCGTACATTTTTAGTC
ATACTAAGTACTCGGAGTATGAAGTATTGAATTGCAGTCACAATGTGACTTACACCGGGACAGCCCAATCTCGACGGCCATTCTACCCGCTCGTTCGGAT
TTTTTTAGGGATGGGAACTACGTAAACTGTAGGGGTTCTCTGCTAGGGAAATCTGCAACCCGTGCACGTGTGCTGTCGCTGCTGTAAAGGCGGCTCCTCG
CCCAGGTCACTTCCGTTTTCGCTCCGCCACCGACAGAACCAACAAAATGGTGAAAGCTCTTTCGTGGCTCCTCGGACTTCCTCTGCTCGCAGCCCCCGCC
GTCAACGGCTACGCTGCTCCTGGAGCGTGCTCTGGAATCTGCGGAAACGCGCACGACCCGTCCATCATCCAAAGCGCCAACGGCACGTACTACCGCTTCT
CGACAGGCAACAAAATCGCTGTCCACA