Description :
From Genome Similarity Track
Location :
Scaffold_23:404414- 409980
Sequence
5566 bases(100 bases per row)
TTGGCCATCATGCACGCGTAAGTGGTCGCCTTCATCTGGGTAGCGTGCTTCACCGTAGACGGCGAGTTGGTCAGTGTGCCGGGTGGATGATTTTTGGTGG
AGGCGTATAACGCGAGGAAGGCACAATGGCCGTTCGCCTTGACATCAACCTCGTGTCCATTGAAGCTGTGGAGCCACTGCCGGACCTGGATCGGTGAGTC
CGCGTCTCCGTCCGCCGTTCCAGTGCGAGAGGCCCCCATGGTGAAGTCTTCTTGGGAATCTGGTGTGGCCGGCACCACCTCGTCCTTGATATCCGGGGTG
TGCTGCTGGTCTTCCTCAATGCATGTGCCTAGCACTGCCTGCTCCGTGGAGCTAGCGCTCGCCTCCTCGAAATCAACACCGCCAGCATTTTTATGTACCG
TACCATGCTCATTTGTACTAGCCCGCTCTTTTCTTCCGCTAGTTGCCGTAGTGCACCTAGCCCCGTTCTGTTCGCATCAATCTGCTTCCGGCGCTTCTCC
TTCGTCGCAGATGCTGTATTGACCAGCTTCTCTTTCTTGAAGACGCCAATCTTGGAGAGACATCGTCGATGGGTACGTCTCATTCTCGAAGCCCAGCGAC
AATAGTAGTGAGACTGAATCCTCGGCAACTTGGCTGGTGGAAAGTAAGTTGACTGGGTATTGTTCCTGCGCAAGCGCAGGCCAGTCGGCCTTTCTCTTGG
GGGATGGGCTTGAACAGCTGCATCCACTCATTATTCTGCATAGCGCTTTGTACGCGGTCGAAAACGCGCTTGGCGGCTGGTGTATCACCGTTGATAGGTG
GGGCCAGGTGCTTTAGCAATTCTGAACGCTTTGCACTCGCCACCGAAGGTTTAGAACCTTAGTTCCATCGCATAGACCGGTTCTGGTCCCGCAACGTCAT
CTAGCTCGTCGGCGAGGTTCCTCGAAAGGGGCCTGGTCGCCCCGCTCAGCCCCGATGATAGCGTGCATAGCTGCAAAGCGTACAGCCGTCACGTCCGCAC
TTGAACTCTCGTTGCGCGCTCCGTCAGACTTGGCACGCGTAGCTGGTACCGTCGGATGTCCTTTCGCCATGCTTCTTGTCTTCTTTTTCTTGTTCTTCTG
CTCTTGGTAGCTCGTAAACGAGAAGACCATACAAACAGTTCACAATGGTCACAATCTGTTCCCGGGTCGCGGCACCAGTTGTGGTGTTGGAATTCCCACG
TGAACTCTAGCTACAAATGTAGTTAGGACGTTCCCACCACAATACGTCTACTAGGATAGTAAACGATCGTTCGGGTGGACCTGAAGACCCCAGTTCTGCC
CTTGCACCGGGACAGACTGGACCTTGTAAACAACTTATATAGGCCAACCAGTTAAACTAAGAACACGCTACTACCACGAGCCAAGCTAGCAGGTGTTATA
AATCCTCGTGATCCGTGGTCCCAACAGTGGAAGGGTACCAGGCACGGGTAAGCGTTTTACGAGAGCACCGAGTGTTCAACACTCGGTTGGAAGAATAAAA
GGGATGCAATCCAAGCACTCCCAGTCGTGCAAATAGGCACCAATAAGCCGTCACGTAAAACCCCCCGATAGTAATCGGCCAATACACAAAGTCTCTTGGC
CTTGCCGGATGAACCCTCGCTACAGAGCTTCGAGTTCACCGACAGGCATAACACACTCAAACAAGCTTGACCAGACGCTTACCTTGAAGCCGGACGTCGC
TCTGTGTGCTTGAGTGGAAATTCTGTTCTGTATTTAAGCTTACCTCTTCGGGTCTATTCCTAATAATAAGTCCTAATCAAGTATACACATATCAAGTGAA
CAATGATCCGTTATGGATCTTCTTGGACGCCAAGCGTCGTCTGCACCGTCGCATGAGTATCTTTAACGGCTGCGCCTTGTCCCAGACGGTGAACGTGCCT
TTAAAGGGTCGCTGAGGCTTCCGCGAACTCATTCCAACCCCCACCGAGGGTTCGTACCGTAGATGGTCAGTTCTTGGCCGCTGAATGCGAATCCGGCCAG
TCCATTATTAATAATAAGGACAGCCTGGATTCAGTGACATATGGACCGTATCTAATATCCGTTGAGAGTTCGGTACTGACGCCGTCGAGTCTCTTGCACC
TTGGAGTCACTGTACATCACATGACCGAGGGTTCGTCACTTGAACATCTTGGGCGGTGTCGCGTCTTTGTCGACGGGCGATTATCCGCAACTATGGAGAA
ATCACTACACCTCACTTCTGCAGCAAATGTTTGTCCATCGCTGACCCAAATGCCAATATATGCCAGTCACGGTATTTCGCCGAGTTCACGCGGACATATC
CCTCATTGGCCAGTACTCCGTGTGGTTGCCATTTTATCACATAAAAGTGAGGTGGGCACCAGACTGACTTGGGTCGTACGTTTGTAATTAATACATGGGT
TGGTCTTCCTCGGCGATTAAAAACAACCGTGGGAATCCAACCCTTCGTCCGTCGCACCCACAAGTCATGCGTCGACTCACTGGGTTGCTGCCTCGGCAAT
TTGAACTCAGCGGTCATTCGACTTTCGATTGTTAACCCGTCTTGTGGCCCACATGGGACATTTGGTCCGAACTCTGTCTTTGTCGGCGCATTACTTGATC
GGATGAGTGGGAATACCATCTCATCGGGTAGCTTGACCGCCGAGTTGTACAGATCTAGACGGATCCCAGCTGCGATCATGAAGTCAGTGCCGAGAATCAA
ATCGACTCCGGCATGATGAGGCATTATCCACACTGTAAACTCGTATGCCACTTCCTAGCCGAGTGTCACCGTCACGACTGCTCGTGACGTTGTCACCATT
CTGTCTTTACTTATTCCCTGTATGTCGATTCACTTGTCCCGGCTGGCCACTCTCTTGAGACGCAGTTTCCTCGCGAAGTACTCACTAATCGCCGAGACAT
TTGCTCCGGTGTCCAATAGTATCTTGGTCCTTCGGTCGTTCACTGCCCCCAATACGAGAGCTCTCATTCTAACTCGGCGATCAAACGTCTGTGCTGATCA
CCATCCCAGCCGTTCTCCCGGAAGCAGCTTCATGATTCTGGTACGATGCACAGCCGGGTCTGACTGCCGAGTTACACTTACAATCGCTCGGTGGTTATCA
TTTAACTCACCGAGCTCACGTTCAATTCCGTCGATTTCACACATCCAATTGCCATCTCCGCTTCTTCCCTCGGGCCGTCCTGCTTCGCCTACGAAGGCAA
ACAAGAAGTTCGCCTCAACTGCAAGTTCAGCTGACGGTGGCAGCCCGGCATATTCCAACCCAGTCAGTGTTGGCGGGCCGCCAAGTTTAAATCACTCGGC
GTGTAAAGGTTTTGCAGGTCTTCTGGCACTTGCGACTTGTCGACAGAGTTTTTCACGAATGCAGCCAGCCTTTCGTAAGATGACCGTCCGCCCCGTATTC
CAACCCAGTCAGTGTTGGCGGGCCGCCGAGTTTAAATCACTCGGCGTGTAAAGGTTTTGCAGGTCCTCTGGCACTTGCGACTTGTCGACAGAGTTTTTCA
CGAACGCAGCCAGCTTCTCGTATTGACGAAACAGCTCGCACTGGCCGACTTCATGGACTTGTCTGTAGAATTTGCAGCGCCACCGACAGTAGCGGGCCGA
GTGCCCCGTTCTTCCACAAGCTGCACAAGGTCCACGCTGTGAGTTGTCGCGTGATCCATCTCCACGGTTCAGCTGTTCTCGTTGGTTGCATGGTCGCGGA
GGTCGACTCGCCGAGTTTTCCCAACTTCGATTCGAGCCATTCTGGTCTACCGCCGAGTTCTCGCGGCGGTCCGTGATATTTCTCTTATCATTGGCAACGC
CGGTGTCTATGTAGTCGTCGTCTTCCGCTGAGTCGTAGCCTCCGGACTGATCCTCACCATCCCATTCGTCTTCGGCGTTGTATGGACTCGGCGGGTTCTG
ATCGAGTAGGGCTTCCCCGTCAGAGTCTGCGTCAACGAAGATGACTCGGCGGTCCCGGTTGTCTTCTTTGCGACTACGCTTCTCATCTCGACGTCCATCT
CGGCGTTCGTATCGGCGCCTTGAATTTTTCCGCTTATCGTCTCGGCCTCGTGCGATCACGAGCCGGTCGCGTTATTTCTTGCGCTTTTCACCGAGGATCC
GACGATTGATTATCTGCTCCACCTTACTAATGTCTTCCAACCGCAAGGGGTACATCAAATCCATCACATCGTCATCTCCACAGTGCAGCAAGAAGTGCTC
GACATGGTCAGATGCGTCGGCGCCACCTATCTCGTACTGGATCTTGGCTGTCCGAGCATACCCATTGAGCCGGATCAAGAAGTCGCAGATCGGCTCGTTG
ACTCTACGTCTCGTCGAGTAGTAGCGAGTGCGGGCGGATTGGTCAAACTGTGAGCAACAATAATCCAGGAACGCCTCGCTGAGTAGTTTCCAACGTCGCT
GAGCCTTCTTCGGCAGCTGCCTATACCAACTCTTCGCCGCGCGTCCCAAGCATAGCGAGAAGGGTTCGCACCAGGCGCTTTGGGGCATCCTTGTCCTCTT
CATCTCGTAGATGAAACACTTGAGCCACTGGAGCGATGCGTCAGAACGGTAGCGTTTCCCTTTGAACTCGGCGATTTTGTCGAGTGAGGCGTGGGTTCGG
ACTTCTAGGTACTGAGTCGAGTCTTCTTCTGCCGCGTCGAAGCTCAAGTTTCGGATGTAGTCCTTCACGATTTATTCACGGTTTCCTCTCACATCGAAGG
CGTCATCGTCATCCTCGTAAGCCTCAGCTTCGTCTGCAGCGTAATATATTTCACGATAGCGACCTGCGTTCCGCTGTCCACGACTCGGCGCTCGCTGAGT
CGGATTGAGCTTCATCGGAGTCAGCATGTGGGAGTCTTCGAAGTACGGAGCCCCTTGCGTAGCGCGGAACACTTCACGTCTCTTCGTCTCCGGGGTCTTC
GGCAAAGGAATTTTGCTTTGGTCTTCGCCGACAGCTTTGAACTTGGCTATGCGGTTGTACACTTGCTTCGTTTTACCAGGGGGCTTCTCCAATCCAAACG
CCACTCTCAACTTCTTCTTTCATTGCCAGAGCTCAGCTCCGGCGCGGGTTAGACTGCAGTCGGACAGGATGCGGCGGTTTGGTCGGCTGTTGCACCGATA
GCCCATCGCCTTCAACAGCAACACCGTTTCTTCCACCAACTGATTGATGTTGGCTGCACGCACCGGTTGAGTTAGCTCGGGACCCAACATCAGTCACTTC
GCCTGCGCCATCGCCACAGGCGCGAGCATCATCATCCATTCCGATCTCGTTCTCATCTCTTCGCCAAGTCGAGCCAACACTTTGTTGGCGCTTGGCGTAT
CGGCGTTCCTTGTCGCTTTCGGAAAAGGGGCGGACGGTCCCCTTGAGCAACGCCATGTTCTTCTCCATCTTCTTCACCGTCCGCACCTTCGTCGAGCTCG
GCGGATAAGTTGCGCTCGACAGGACGTGGGGCTCCCATGCGTCCCGCCTGTAGCGTCAACTCTTCCACCTCGCCAAGTAGCTCGGCGGTAGTCTTCGTTT
CTCCGAGCTCAGCGGTCTCGGCCTTCTCTTCATACTCTCCTTCACTTGCATCTCCGTTCTCGCTCC