Description :
From Genome Similarity Track
Location :
Scaffold_254:4044- 8728
Transcript NameFunction/comments
Phypl_g6012hypothetical protein PHYSODRAFT_553035
Phypl_g6013hypothetical protein PHYSODRAFT_553039

Sequence
4684 bases(100 bases per row)
TTGCTGCCAACCAAACGTCAATTACAAGTTTGCATCCGCATTAACTGGGTCGCAATGGCTCCGACGGCAGGTgcgtcttgctgcttccAGCCCTTCATGC
CTCTATCCACTAGCTTcccagcagcctccgacCTTCCTCTAACCAGTCCACGCTCTGTCTcgctccaggaactcgtcTCCGCTTCAAGAACGCGCActcc
aagaagccgcagcaggccaagaaggtccCGTCGCTCAAGAACCGCATCCGGGGCCTTGAGCGCTTCCTCAATCGCGGGGTGCGTCGCCCCTAGTGTTGCA
ATCATATCGCGGCAATTGCACAGGTCTAAACAGTGAGTGGGCTATTGGTTTACAGGGCCTGGCTGATGCCACGCGGAgagccaagaaggcggagctcgag
cagctcaaggaggaggtgaGTGAACTCTCGTGTGCTGCAACAGGTTGAGCGGCTGTGCACTGAAGTGTGTTATGTTGGTGGTTTCTCAGCACGGGACGAA
GGAGCAAGTTGCACAGGACAAGAAGAATGCAGAGAAATACAAGCGAgtgcgttgctgcagctgctggaataCTTGCAAGTTTTTATTGTGTGTGTTGCGG
GAATCTAACGAGTCGGTTTTACACATGCTTTCATCCTGTGTTAGCCTCGCTTTTTCGAGCGCGTGAAGGTcatgcgcaagctgcgccaggCGAAGAACCG
CGTTGAGCAGGTGAGGAAGCCAGGATCTGTTGCTGCTATTGCTTGCATCTCTCTACATTGTTGGTCGAAATGCTCACTCTTCTTTTTGATATTGTTGCAG
GCAACTGACGACGCGGAACGCGCTgagcacgagaagaagttTGAGACGTACCGCAAGGAGATGATGTACATCTACTACTACCCGAAAACGGAGCCGTACC
TTTCGCTGTTCCCGTCTGCACCTCACTCGGAAGAGAACCAGAaacagcagaaggagctTCGTGCTGAAGCGGTTGGTCGCTTCGAGGAGGAACAGCCGAC
GGAGGCGTTCCACCACTTTTgcttcaacgacgacaagtcTAAGGAGTCGAGCTCTGCGGGTGAGTCGAGATCGGCGGTGGAACTTTTGCTCAAAAAGCCC
ACGAAGGAACAGGTGAAGAAGCAAAAGAAGGCccgcagcaagcgcgacAGGTCTGGTGAAAAGCCGAAGCACACACCGGCTCTTGTTGAccaggatgacg
acgacgaaatgCCCGATGCATCGAAGGCAGAGAGTGAcaaggaagaagacgaggaagaggaccaggaagaggacgacTTCTTCCTGTAATTTTGCCATAG
ACCGACAGCAGTGCGGGACGTTTGTACTTTCGAGGTCATGGGTTTCTTGGAATTTATTACTAATAGTCTTTACGCTGACGAGCTCATACGCGAAGAGGAG
GCAGGATAACTTGGTCACGAGGATAAGGCTGTAGAAAAGGATGATGAAGAATTGGGCGTTCTTGAAACGCAGCTAGATCAGGATAGATGGACCGGACTCA
GTTCCCACGGTTTGCTGCTCCGTATCGGTGATCATGtccgcttcagcttgcgaTGCGGCAGCCAGCGCATTCATGTTTGTAAAACTGAAAGACCTGAAGG
CATCCGAGAGGTTGGAATCATCGGGACTACCGTACATGCCACTAGGGAACCGATGGTGGCTGTTGTTGTCTTCCATCTGCACATCGTCGCCAAAGCATTC
TTCCTGAGCAGCTCCCATTGCATCTAGCGTGCCTAGTGCCCCTGCGGTTCCCCACGACATGTCAACATCCGCTGTGGAAGCAGAAGCAATACTAGCGGTG
TTGTTTCCAGTGTCACAGTCTTCCTCTCTATTCGGGTCAAATGGACTTGGTggctgctcgtcgctctcgggTCCGGAGTCAATGTTGTTCTGACTGCTAC
TGGTAGAGCGGGAAGCATCATCAAactcatcgtcgtcgatgaaTATATCAGTGAGATTACGGTTGTTGAAATAGCTGGTGTCGTTCGGTCCCTCCAGCGT
CGGCACGAACGGAGGCACGGACTCCAAAATCGTATCCCAGTTGATACCATCGAAAAACGAATGCAGCATGATACCCTCCCAGCCCATGCGGGTCGCCGGG
TTCGGGTCAAGCAGCTTGCCTATCAAATCCATCGCCTCAAGTGACAAGCACTTCTCGCCGTCGGGCCACAGGATTTGCCGCTCTAGAATGTTCCCGAAGA
TCGCGTCCACGGTGTCATCGTTGAACGGAGGAAACCCAACCAGCATTTCGTAGAGGATGATTCCTAGTGCCCAGTAGTCCACAGGCGGGCCATGAGGGAC
GCCGAGAATGATTTCAGGGGCCAGATAGTCGGGAGTACCGCATCGACCATACGTGTGGTACGCCGACTTCTTTTTCGAACCCCTTCTGGATGACGAGGCG
TGCCGCGGAGGGGGGGATGCTAACGGTGCATCCCCCAGCGCGGTGCCAGCTAATATCTCCGAGTCCTGGGCCACGGACTCATCGTCAGGCTCCGAATCGG
TGTCACTAATGGCAACCGCTTCCTCGGACAAGCCGAAGTCAGTCAGCTATAGGGCAAAAAGTGCAATTGCGATCAGAGTCGAGACGACGTTGGTAAGGGG
CTGAAAATCAGCGAAGCAAACGCACCTTAATGTGGCCGGTAGAAGAGAGTAAAATGTTGTCGGGCTTCAGATCTCTGCATAATTGTATGCCAAAACCCAG
GCAAGTGGATAGACGGACGAATGAATGAGTGAGTCAGAGTGCAAATAATGCAAGCATAACCGACCAAAGCGCAGGTCGAACCTGTGAACGCAGCCTTTGG
TATGCAAGTGATTGAGTGCAATTGCAATCTCCGCGATATAGACGCATGCCACCTACAACGGAAAACATCGCATATTTGTCAAGAGTCATCGACGGGGTGT
TTGGCTGCTCAATATCTCAAGCTTAcctgctcttccagctgcacaATGCACTCCAGCAATGACATGAAATCACCTCCAGGAAGATACTCCATCACCAAAA
AGAGATTGCGCCTAGTGATACAAAATAAATGTCCTCGGAATATAAGTTGTTGCTCGCCTCGATATGCGAGCTTTTTACTGCATCACGAATATGGACTGCT
TACTTGGTTTGGAACGTCCAGAACAACTTCACAACGAAGGGGCTGACCACACTGGCCAGAATGTTCCTCTCTGTCTCAATCTGCTGAATCTGTGGTGGCA
CACAAAGCGATCAACGGAGCATACGCTCAGTAGGGCAGCACTGTGATTGTGAGCACGCTATGCCAGCAGACAATGCGCTGTACCTGCTTTTTGCGTAGTA
AATGCTCTTTCGCGAGCACTTTAATCGCGTACTGGTCGCctgtcgtcttcttccgtGCAAGGTACACCTTGCCAAAAGCGCCCTTCGAGATCGGCTTCAC
AATTTGGAAATCACGAATAGAGACGCGGTAGGACGCCGCCGGCttcaagctcgagcgccgccgcgctctcACGTTGTCACTGTTCTCGATAtcctccagc
gacttggTGCGCTTCAGCGGCGCTCGTACAACATCTCCCGGGTTCTGCTGGAACATTACCTTGTGCGACGCGCGCATTTTGCTCATCTTGGCGTGGATCA
AGTTGCGCAGCTTCGCGCAATACTTGACGCCCCGGTCGACGCCAAAATTTGATATTTCCACCTCCTGTTGTCGTATTCTATCGATAATTTTCACGAGTCG
GGCACAGAGCGCGAACGCATCCACACTAGTCACGTCACAAGTAGACGCCTGGATCGCCACCACACGCAGTGCGTGGTAGATATGCATCTCCTCCGGGTTA
AATATCGGCCtcagcgcctgcgcctcAAGCGTCGTGTTAATGGACTCCGTGAGCTTCACCAGCGAGTTGTTGATGACgtccgcttccagctccacccTCT
TGGACAGCACGCAGAAGTTGGTGTGCTCGTCCAGGCTGTTGGCGTCCACCTTCGTCTCGCAGAGCTTGCACACGACCACCGACTTGTTCGCGCGTCGGAA
CTTGACCGTCATGGGTCGTTTGCTGAACTGCaggttgtccagcacgtcctcgggTGACTTGGCGCTCACATCCCGTCCGTTCACAGCCTCCACAGCCAAC
CCCCTGGTGATCGTGACCCCCGGCGGGATGTGCATGACCACAGTCGCCCACGTCTCGAGGTGGACGCTCTTAATCACGAccttgctcttgagcgcgtcga
acacgaactcgaggccgaggaagCCGTCCCCGAAGGTCACGTCGAAGGCCTCGGTCTTCTGGATGTTCTCGAACAggtcctcgccgtcctccagcatggc
ggcggcggcggcgtccgcatcggcatcggcgtCCGCGCTCTCCTCCTGGTTGCCGTCCTGgccgtcgctggacgcgAAGCGGCGCCACTTGACCTGGTTC
TTCTCCCAGCGGTtcagcacgtcctccagcacgtctggcgtggcgtccagcagcccgGAACGGGACATGGAGGCCCCGCCGGCGCTGAAGGGCGGCACGT
TGAGCGTGtactggcgctgcagacgctggggCTGGATCTCGAGGCGCAACTCTTCGTGCAGACGTTCcatgtcgctgctgctcgtgctgctgttgctcgt
GCGGCGCCCGCTGCGGTCACTCgggagctccagctccgccacgcGGGCcagggcgagctgctgcggccgctcgGCCATGAGGAA