Description :
From Genome Similarity Track
Location :
Scaffold_47:40437- 41505
Sequence
1068 bases(100 bases per row)
ATGTGAAGTCCACAAATTCGAGCTTTCCGTCTTTGTTTCCACGATGCATCGCAAAAATGCGTGACTCGATGCTACTGGGGATTACGTTGCGTAGGTGAGC
CAACCATTTCTGATTTTCAAGCTCGTTCTCTGCTGCGAAATACAAGCGACCCTCTTTGTTCCGACCTTCCAGTAACTTCGGTGAATGAATCTCAAACGCA
TATGGAACATCCATACTCTTCTTAAATAGGGCCGTGCTCAAATCGATAGTTTTTGAACTACCTCCCTGTAGAGTAGCCGGTTTGTCATTTGCATAATACT
GAAGCTGTGGGTGGTGATCTTCGTTGACAGACAAAACAACGTAGCGCCTCATCCACCGAGAAGTTTCACGTCGTTTTTtCAAGTATCCTTGATACACAAT
TCCGACAGGTATGCTGACGGAGTCTTGCTCTGGGCCCTcTTCATTTTTGTGCATTCTTTTCTCGACCACTTGGTTTCCAGCACCGTCGCACCCAACGAGA
TGCTTCCATCCACCTGGTAAAGGGTGCACAGGAACTTGCTTATCTTCGACAAGCTTTCCCcAATGCATCAAAAaCTTCGCCATTTCGTACTGCCCAAAAG
CgCATGCTTCATGGAACGCTATGTTTCCACGCCCATTGCGAGTGTAGAAAAGATCCTTCTTGTCTACTACTGTGTCAAGCATATACTTGACAACGTGGAA
GTCACCACACCCTGCAGCATGATGAAATAATGTGTTGTATCCGTAGGCCTTGGGTTGCAAGTTGAAGTATAGTTGCGGATTTGCTCGAAGTTTATGCATT
CGTCTGTCCGACTCCTCCATTTTGGCATGGTTTCGACTCGAAGGTGACGTAGGAGCAAcTCCCCcGGATGATcTACCCAGGCAGCCGCCATTTCCAAAGA
GGATTGACAGCtCTTTTtGCCATGTCTTCGCGCGGTGATACTTGCGCCATCGTGtcTGAACACaTTTtGCGGACAGCTTGATTTGCCTATACTCCTTCCT
CAGCAACCAACTTTTCACAATGTACTGAATACATACGGCAGAGTGCTGCATTGCGAGGTAATGGGTGC