Description :
From Genome Similarity Track
Location :
Scaffold_39:404193- 410364
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011933Similar to At2g30105: LRR repeats and ubiquitin-like domain-containing protein At2g30105 (Arabidopsis thaliana)
Pytul_DAOMBR144PYU1_G011932Similar to DDB_G0289943: Protein CLEC16A homolog (Dictyostelium discoideum)
Pytul_DAOMBR144PYU1_G011931Similar to SPTLC2: Serine palmitoyltransferase 2 (Homo sapiens)

Sequence
6171 bases(100 bases per row)
ATCAGGTGCTCAATCTCGTCATCAAAGTCGCCGCGCTCTTCAAGGTAAAGCAGCCTGTAGAAACAGACAGCAGTGGAAAGTCAAAGCGCGTCAACACTAA
CAAACTTACTTCATGTCTGCCAACAGAACACCAAGGAACTGCGAAGCCTGACAGCGGATGTGCCAGTTGTCTTCCCCGTGGAGTTTCTCAACGCCAATCC
GCTCAAGATCCGCGCCGTGTTCCTACGAATGAAAGCCGACGTGCTCGGCACGTCATCGACAACGAGTGCAAACAACAAGACCACGACAGCAAAGACGACA
CTGCACGCGACGAAAAAGCATAAATAATATCTCTCTTTCGCGTATCTGTTTGTCTTTCATATGCTCGAGGGTGCTGTGACGAATAAAGGTGCTTTGATAA
CGAAATACTTCGAAGGAATCCATTGTTTTCTTCTATCGCTTCATTGCTTCTTCTTCGTCTTTTTCTTGCTGCATTCGCTTTTCCTCGACGTCCATCGAGA
GCCGTCGCGCTTTGGTCTTCGGACTCACGGCGTTCGCCGAGTGCGTGATCTGCACGTGCGTATTCAGACTTTCTTCGATCTGCAGCAGTTTAAACGCACG
GACTTCGGCGCGAGAGAGATCCACATGCGCCTTCGCTTGCTTGCAATCCTCGTGGTTGTCAAACAGCACCGACACGTGCCAGCTCTTCAAAAAATCCCCC
AACTGAGACGACTTGCCCTTGACGAGACTGCTTCCTTTGTGGTAACTCCGGCACCCGTCCACCGGCGCCGCCGACGAGATTGTGACGTGGAGCACGCGGT
CGTCTTTCGAGTCGATCGTGCAGTACGTGCGGTGAATTGGCGCAAAGAGCCGCACGAACCCAACTCCCTCCGTGGTTTCGCTGTCGCTATCGCTCTGGAC
TGCAGACGACACTTGCTCATCCTTCTCGGCAAACACGAGCGCTTCCGGGTTCAAGATCATGAGCAGCTTCGCGGGCGAATGCAGAAAGCGCTGCTCGCGC
CAAATGCACTTGAGAAAAACCATGCCTTCCATCGAGACCGTCGTACCGCTGGTGCGCGCCGCGTCCAGCAGACTTGTGTGAGGGTGACGGAACGCTACAA
ACTGCTCCAGGTTGTCGGCGACGTACTGGTCGTCCACGAGTTGACGAAGGCGGCGCAGCGTCAGGAACTCCCGCATCGACTTGCGACACACCTCCATTTC
GTTCGCGGGGCTGCGTAGATTCAATGTGCCTTTGCGATCCGAGATATAGTCGACCACGGGTGGTATTAAAAACTCGAACGGTGACGATGTCTTAAAATTG
AGTGCGATCGGGAACTTGGCGCGCTGAAACGTGTCAAACTCGTCTTCGAGCACGTAGATAAACAGATCGACATCGGCCATCGCGCCGCGCATGCTCTCCA
TTACCTGGTGGGTGCTGATGGAGTGGATCTGCTGGAGTACCGTGGCGTGTCGAGGCAAGAGCCAATGGGTCGAGTTCGTCGCCACCATGATGTCCACCGC
AAGGCGAGCAGCAAGTTGCGTGTTCAAAAGTCGCGTGTCCGGGTTTCGCGAAAGAATCGTAAGGAGCTGATCCATCAGCCAGTGCGGGTACTGTCCGACA
TAGCACTCTGTCGCAAGTGGATCTGATCCGCGCGTGCTGCCACCAATGGATGAACTGCGTGGGTCCGTACTGGTATCGTGTGCGTCGTCGCCCTGACCGA
CCGGTTCTTCATGCACCGCTTTCTCATCGTCCTCTTTCTCGTTACTTTCCTCTTCATCCTCGATTTGAGATGTGGACGAGACCGAGAGATTAGATGACGA
CGTAGAGGACACGACGCTGCTCTCGCCGCGGTCTTCATCGCCTGACGCGTCCTCGTCGCCTGCGTTATCAGATCCCTCGGGTACGTGGACGAGTGGCAAC
TCGGACGCCGTCCCGATGCTTCGTCGACGCTTTCGGTGTCGAAAGGGCAGCAAATCGAGTTCGCGCAACAACGTGTGGTCAATCGCGTCATTGTTGACAA
TCGCGAGCAGCAGCAGAAGCGCAGCTGAGGACAGCAACTCGTCGCTCGATGCCAACAGCGCCAAGATCGATTGACGTGTAACATTGTTTGCTTGCCCAGG
GACAAATGCCTCGACTTCCTCGAGAGGCCACTCGCCCTGATCGAACCGCGTTTGCAAGTAGCAAAGCGGTGAGTTGCAGGTTTCTGCCGAATGCACTTGG
AAGACATGCACCGTTTTCTTTTTCTTTGTTTTCAGGGTACTCTTGCGTTTGGTCTTGGTGGTGTCCCCAGCTGGCGCTGGGACTTGCTTGACTGCTGTCG
TCGCTGTCGTCGCTGTCGTCGCTGTCGTCGCTGTCGTGGGTGACGGGACCTTTCCACGAACGCTTTTCCGGCGAGACCCCGCACCGAGCGCAACCGCCGA
GTATGGGCATTTCTCATTGGCATCTGGAGAAAGCAACCTAAAGACATGGTGAAGGACGTTGATGAGCCTCTTCCAACAATTCCGCAATCAGAGACAAAAG
CGCAAAATAAAAATAATAGCAACGTACATGAACGCGACCGCATTGACGAGCGGCGCGTGCTCGAAGATACCCGTGAGCCGCGTGAGCAAGTAGAGCGCGA
GCCGCGTCGACACGCGCTGCAGCGGCGGATTGCAATCGGGCAGCACGCTCGCGGCCAGAAACTGTTTCACATGGCGTCTGTACAGCAGATCGCCCACTTT
GTAGCAGAGCTCGGGGAGGTTGATGTCCAGGATGTCCTGCAGGTAGAAGCAGTGGTCGATGTACTCGTCGACCGCTTCTTCGAGCCTGTCGATGACCGTG
GCGCCCATGCTGGGCGACCAGAGGTTGAGCAGCCCCTGGATCTTGAGTGCGAGCTCGTTCGCGTACTCGACCGTGTCGCGGAAGTACGCCATCTTCTGGT
ACCGCACGATGAACTCGCGCACGCGGTCGTCTTGCACCTTGTACACGTTGAGCGTGAGCGTCTTGACCGCGACCTTGACCATCGTCTCGGGGCACCGCTT
AAACGTCAGCGCCTGCGTGTAGAGCGGGAAGAACGCGCCGTCGTGTGCGCGCGTGTCGAAGAAGAACTGCACCGTGTCCTCGTTCAGGCGCAGCGACAGC
GCCTTGAGCAGCGTCACGTACCAGTCGCGCACGTCGTCGTCCTTGGTCACGGCGAACGGGCACAGCAGCAGCTTGTTGACGTAGTTGTTGGAGAGAAGGT
AGTAGAGCGACGTGCGCGTCGCGATGTTCTGCACGAGGATGCTCATGGTTTGCAGCAGCTGAATCTGCACGGCGACACTCGGTCGCGCCTCGCCCAGCTG
CACGAACAGCGCGAGGATGTTCTTCTCACAGAAGTAGTCAAAGAACACGCCGGCGCCTGACGTCGTCGCCGCGAACTCGAGCGACTCGAGCGACTCGCGC
GCATGATCATCCTGCTCGCCGTTGGTATGCTGCTGTTGCTGGTTGCTGTCGCTGTCGCGCTGCTGGTGGTCGTGGTTCTGGTCCGAGTAGATGAGAAACT
CCGAGAGCACGCGCAGCAGCTCGACGATCTCGACGTCGCCCAGCTCCGCGAAGCGCAGCAGCTGCGCGTGCAAGTGGCGCATGCTCGCAAGCGAGAACTC
GCGCGGCCGTGAGAGGAAGCCACCACCGCGGTGGTGGCGCGCGCCGGAGCCGCTGCCGCCCGTGAGCCACGCCCACATCCTCGCACACGAATGGGCCTCT
TGGGGGGCGGAATAAACTGGAGTCGAAGAGAAGGAACCTATGCGCGCTCTAAATGGGGTAATCTTTAATCTGATGATAACGTTAGACAGGGTGGAAGTTT
CCACTGTAGGCGATGCTGCAAATGGCGAATAATATTTTAGAGAGGGCATCTGCTGTGAAGCAAACTACAAAGGATCGTGGGTCGGATTCTCTCAAGTGAT
AGTGATCGCAACAAAACAATCGCTATAAAATCAGTGAAATTACAGCATTTAGACAGATGATAATACACAACAACGGCTAATGTAGGTAGATATTATAATA
GAGGGTATACCACATTAGACATCTTGAAAAGAGCTCTTCGTTCGGCACAACTGGGTTCAATTGCACCAATACGCACCTTTCTGCTCACTCTTATTTCTTG
CTGCGCGCTTTCAGGATCCGTCGGCCCTTCATGTGCACTGGCGGCGCTGCGCCAATTTGGAAGCCACTTCCTCCAGTAGACTCGGAGCCGAACACAGGGC
CACCACCACGCACGCCAGCTGCGTTGCGCACTGAGCCATTTGGTGCACCACCGCTCAAGACGAACAGAGCTGGCGGCACTCTTGTAGCAGGGACCACAGG
CGCACGCTTAAGGCTCACTGGAAATGCTGGACTCTTGAAAGTAGATGAAGTGAACGTGTACGTCTCGTTTCGCATCGCAAATTCCCCATCACCTTCACGC
CATGCTGACGCAACATCTTTCGAATCAAATTCGTGGCGACCGAAAGTCTTGGCACCAAACGCCTGGGCTGCTACTCGACGCGCAGCAGCAGCTGCACCTG
TGGGCCGTGCAGCATTATGCGAATGTGCTCGTGACCGTCGGGCTTTTGCACCGTGACGGTGTCTCTTGCAGCGAAACACTGGTGGTGCAACACCAATCGA
GAATCCATCCCCAAGCGAGTAACAAAATGGCGTTGTGGCGTGAAACGGCGTCTTTGTTCCAACGCCTAATGCCAACTGAGGCGACAATGCACCAAGTGGA
ACGCGATCTTGTACGCTCAACGGACTGGAAGTTTGCTGGCTCGGTGTACTTTTAGCATTATCAAACATTGTGATCCCGATTCCGCTGGAAACACTAAGCG
GCGTGCTCGAAGGTGTGCTGAACTCTCGCTCCGCTGCTCGTAGCACTTCGGAACCACCAAAAAGCGGCGCTGGAGCTCCTGTAGGGGACGCTGCAGCGCT
CTGCTGCATTGTGTGGCGCCCCGCCGTTTTGCGCATCTTGACAACGACATCCAACTTGGAGGTGTAGGCCACGTACTGTCTCGGCGGCGGCATCGTGTCG
TTGCTTCTTTGAATTTTGGATGACAAGGCATTAACGCAGGCAGGTTGGTGAGAGGGACCACAAGACTGAACGAGCCGCACAGCAGAGGCAAAAACAAAAT
TATACTACAGTAAAACTGTATGTTATGACCTATAATTAGCTTTTTGAGGTAAATAAAATGTTTGGTAAAACTTTCTTCAAGTTTTCATAAAATCCACCTG
GTAGGAATAGGAGTGACCGCATCGATCAAAGGCAAGCGTTGCCGCTCCCGACTGGCCTGGACACAAATAATGTGCATGGGTTAGTATTAATTTAAATACT
AATATTTGTATAGGTAAATGTGTATTATGTCAAGGCTACGCTTGGTTACGGTGGCTAACAATCGAGAGTAATGGCCCCCGCCGTCTGTGTACACCGCAAA
GCACATGGCAGCAATAGACCAATGTCATGATGATAGATTACGTAGGAATGTTGGCCAGTGGGCTGAACCTGATCTCGACAAAGGTTGCGTCTATAAGTTG
GGGTGACTTTCTCCTGGTTGCATTGGGCTGCCCTCAGAGAGAGCGGCTCAATCCATCGACGCGCGCGGTTCAGCAATAACTGCGCGAAGAGTCTTAAGCC
TAAGACTACTTACTATAAGTGGCAAATTTGGTCTTCCGGGTACTTGTTATTCAAGTACTCAAAAGTCGGGATAGTAAGTATTTTCTTAAAAATATTTTAA
AAGAATCAATGCGTCAAGTTCCTGAAAAATCACATTAATTAGTAAAATTTCACTAGAATATGACCTTTTTGTTGCACCTTTAGAAGTGCTACCATCACTC
ACGGCTGATGCGAACTTAACATTGTCTTGCGACCTTGACGCCATACGCGCCAATTTCAGCTTACTGCGACCGCGGGCTCTACAGCGGCGGCAGGTGAGCC
CTCTTTTACGATTTCGTTGAGCCAGGCGCTACTCTGGATGCTGCTCGAGAGTTTACAATGCGTGGTTCATATATTGTGTAGTGTTCAGTGTTCTCATGAA
GTTTATACGACCTTCTTGTGTTTGACCTCGTTCTTTAAGAAGCGAACGGCGCACAAGTCGCTCACCTCCTTCACGATCTCGAGCGCTTCGTCCATATCCT
TCCGGGTGTGGGCCGCCGAAATGCAGAAGCGCACGCGTCCGAGCAGCAACGGTGTGGCGGGGAACCCGACA