Description :
From Genome Similarity Track
Location :
contig_20:40411- 41962
Transcript NameFunction/comments
g4935.t1ABG66536.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
1551 bases(100 bases per row)
CGGATTGCGCGGACTGCGCGGCATTCGCGGATGGGGTGATTCCCGTGGGTGATTTCTGCTTGGGTTTGATGGACCCATACACCGTCTTTCCTTGTCTCGC
CTTCGCACGTTGTCGGGATCGCAGTGTCTCTTCGAGAGTGTCTGCGTCCGGAATTCTTAGCAGTGCCAGTTGGCTGGCTAGATCGCGATCGTCGAGTGTT
TCGATGAAGTGATCGACATGTTCACGGCGGACCTCAATCGATCCATCCTTGATCGAGAGCTGAGCTCGCAAACCAGCGACATTCAGACGGTGCAGATATT
CCAGCGGCGATTCATCCGATCGCTTTCGCGCATGGTAGTATTGTCTCGCGACAGACACGCCACGTCCGCAGTATTGAGTCTGGAAGTTCTTAGACAAGCT
CTTCCAGTTGCCGCGCGTCGTCCGACTCAGCTGTCGGTACCAGTTACGTGCGGGTCCAGTGAGCAGATCTACAAACACCAGACACTTCTCGCCATCAGGA
GCTTGAACGCGGACAAAGACAGACTTCAGTTTGCCGAACCAGCTTCTGGCACGATCTTCGTCGTTATCCTTCCCCGAAAATTCCTTCAGTTCTGAGATCG
CGGAGACTCGGATCCTTGTGGCTGAGAGTGTTCCGCCGCCTGTAGTCCCAGCAGATGCGACTGCGGCACGAGGGGTAGCGTCGACACCCAGGTCATCCGG
ATCGTATTCGCTCGGGTGCGAATGGTCCCGGCGATTCGACTCCACGGACTCCATGTCAACGTCTTGAGCTCCAGGTGGCTTGGTTTGGTCGACGACTGGC
GTGGTCGAGACCGCTTGCTGTTCCTTCAGGAAACGCTCCATTGCTGCATTGAAGAACGATTGCATGCGTTCAGGGGGAGCTTGGGCTGGATCGCTCGTCG
CGATAACTGTCGGCTTGGTTTCCGATCTCTCCTTTCGCGACTGTAGCATGGCTGCTCCGGCCGGCCCAAGTGTCATCCGCTGCAGCTCGATCGAGCTGTC
CGATCCCGCTTCGGATGTGGCTGAGGCATATTGCGACGATCCGGTTTGGCTGCGAGTCGGTGCTGGTCTTTCACGTTGAACCGGGACGACACTACCGACA
AGGGGCGTCAGCTTCGCGAACAGGCTCAGCGTTGATTCCCTGATGATTGGCAATTCCAAGTCGAATAGCTCGTTCGCGTCGAAGGAGCCGAGCACGATTC
CCGCTTCTTTCAGCATGCGCATCAGCAGTTTCACTGCCTCGAGTTGGCTGGTTACTTCCTTCGGTGCCTTCACTGGACCTTGCAGTTCCCCGATTGGCTT
CGGGCGCACGATCTTCATTACAGGGTCTTCGTGCAGGAACTTGTAAAGGTCCTTGTAGAAGAAGGCAGACTCCAGTTGCTCGTCCGTCCACGTGTTGCAA
TCCTCCTGGTCTTCGGCTTCAGACTCCGGTGCCTTCAGCTTCTTGCGTGAGGTCTTCGACTTCTTCTTCTTCGAGGTTGCGTGCGGAACTGGAGGAGTGG
TTTTGGATGAAGGTCCTTCGGTTTTCACCGTCGGACCTTCGTCCGGCGGAT